A total number of 60 children aged 5-12 years participated in the study. The first group included 30 children without black stain (control group), while the second group comprised 30 children with at least six black-stained teeth (experimental group). No significant differences in age or sex were observed between the groups. None of the participants had systemic or infectious diseases, nor had they used antibiotics two weeks prior to sample collection. The study was conducted in accordance with the Helsinki Declaration and was approved by the Committee for Scientific Research Ethics at the Medical University of Plovdiv, Bulgaria (Approval No. 6/05.10.2023). The research was carried out at the Department of Pediatric Dentistry in Plovdiv, Bulgaria, between January and June 2024. Written informed consent was obtained from the parents of all children enrolled in the study.

Samples from both groups were collected at the Department of Pediatric Dentistry between 8:00 and 12:00 a.m. Participants were instructed not to brush their teeth the evening before sample collection and to refrain from eating breakfast on the day of the visit. These instructions were given to standardize oral conditions before sample collection and to minimize the influence of recent oral hygiene or food intake on the results. Subjects were asked to rinse their mouths with clean water before sample collection. Dental plaque and black stain samples were collected by gently scraping tooth surfaces with individual sterile metal curettes, taking care not to remove enamel unnecessarily.^[11] Approximately 1-2 mg of each sample was transferred onto sterile endodontic paper point^[20] and stored in sterile 1.5 ml Eppendorf tubes at −22°C until further processing. All samples were placed on ice before being transported to the laboratory. The collection, handling, and storage procedures are presented in Fig. 3.

Genomic DNA was extracted using a commercial bacterial DNA kit (Genaxxon Biosciences, Germany) according to a protocol optimized for bacterial samples. Samples were incubated with 200 µL Tris-EDTA buffer (pH 7.9) supplemented with 40 µL lysozyme (100 mg/mL) at 37°C for 2 hours. After enzymatic lysis, 300 µL lysis buffer and 17 µL proteinase K (20 mg/mL) were added, followed by incubation at 55°C for 10 minutes. DNA was purified using silica spin columns, washed, and eluted in 25 µL elution buffer.

Primers targeting the V1–V3 and V4–V6 regions of the 16S rRNA gene were selected based on Church et al. (2020). ^[21]

V1–V3:

Forward 5’–AAGAGTTTGATCATGGCTCA–3’

Reverse 5’–TTACCGCGGCTGCTGGCAC–3’

V4–V6:

Forward 5’–GTGCCAGCAGCCGCGGTAA–3’

Reverse 5’–GAGCTGACGACAGCCATGC–3’

Each 25 µL PCR reaction contained 12.5 µL 2× Master Mix, 1 µL of each primer (10 µM), 5 µL template DNA, and 5.5 µL deionized water. PCR cycling conditions:

V1–V3: 95°C/10 min; 30 cycles of 94°C/30 s, 57°C/30 s, 72°C/30 s; final extension 72°C/10 min.

V4–V6: 95°C/10 min; 30 cycles of 94°C/30 s, 53°C/30 s, 72°C/30 s; final extension 72°C/10 min.

PCR products (~500 bp) were verified on 2% agarose gels with a 50 bp DNA ladder.

Specific PCR products were enzymatically purified using Exonuclease I and Shrimp Alkaline Phosphatase (37°C/15 min, enzyme inactivation 85°C/15 min). Sequencing reactions were performed with the forward primer using the BigDye Terminator v. 3.1 kit, followed by capillary electrophoresis on an ABI PRISM 310 Genetic Analyzer.

Chromatograms were analyzed using Sequencing Analysis v. 5.2. Bacterial species were identified by BLAST against the NCBI GenBank database. Representative sequences were recorded for reference.

For each of the 60 analyzed samples, two specific PCR products were successfully obtained, corresponding to the V1–V3 and V4–V6 variable regions of the 16S rRNA gene. Representative amplicons (~500 bp) are shown in Figs 4 and 5.

All tested samples yielded specific PCR products of approximately 500 bp, corresponding to the expected size for the V1–V3 variable region of the 16S rRNA gene, confirming successful DNA amplification and suitability for subsequent sequencing. Clear and distinct single bands observed in both control (lanes 2-5) and black stain (lanes 9-12) samples indicate successful and specific amplification of the target region, confirming that the extracted DNA was of good quality and suitable for further sequencing analysis. Similar amplification patterns were obtained for the V4–V6 region, confirming consistent DNA quality and amplification efficiency across both variable regions.

The predominant bacterial species identified in both groups are summarized in Fig. 6, while the presence of selected bacterial genera and the results of Fisher’s exact test are presented in Table 1. Distinct microbial profiles were observed between children with and without black stain. Notably, black stain samples exhibited a significant increase in Actinomyces sp. and the presence of newly detected Gram-negative taxa (Burkholderia and Neisseria), whereas the control group was dominated by Streptococcus and Veillonella species. Comparative analysis revealed a shift in the Gram-positive/Gram-negative balance. Actinomyces sp. showed a strong association with black stain, increasing from 3 to 10 occurrences, while Streptococcus sp. decreased (from 10 to 3). Treponema sp. exhibited a slight increase, potentially reflecting its contribution to subgingival biofilm activity. In contrast, Selenomonas sp. and Veillonella sp. were absent in the experimental group with black stain. Newly detected taxa, Burkholderia and Neisseria, appeared exclusively in black stain samples, indicating a possible adaptation to the rich in iron and low oxygen environment of the chromogenic biofilm.

Presence of selected bacterial genera was evaluated in the control group versus the black stain (BS) group using Fisher’s exact test. None of the genera yielded a p-value below the conventional significance threshold of 0.05, therefore no statistically significant associations were demonstrated in this dataset. Treponema sp. and Eikenella each produced p=1.000, clearly indicating non-significance. Streptococcus and Actinomyces sp. both returned p=0.057, which is close to but still above 0.05. Selenomonas and Neisseria each returned p=0.052, slightly above the threshold. Veillonella, Burkholderiales bacteria and Bacillus cereus yielded p=0.237 or 1.000, also non-significant. Although the raw counts show descriptive differences for some genera, such as a higher frequency of actinomyces in the BS group and a higher frequency of Streptococcus in the control group, these differences did not attain formal statistical significance with the current sample size and observed distribution of data. Consequently, the findings remain descriptive and confirmation of any associations would require larger samples or additional analytical approaches.

Taxonomic categorization, as presented in Table 2, highlights broader ecological patterns in the microbial communities. In black stain samples, the microbial community shifts toward filamentous and rod-shaped forms, while Gram-negative taxa increase in diversity. Cocci such as Veillonella are replaced by Neisseria, and Actinomyces remains dominant among filamentous bacteria, consistent with the biofilm’s structural stability.

The identification of these taxa supports the hypothesis that black extrinsic stain in children represents a complex, metabolically active biofilm rather than a simple pigment accumulation. The coexistence of Actinomyces with anaerobic genera such as Eikenella and Treponema reflects a structured ecological consortium potentially involved in biofilm maturation, iron accumulation and pigment biosynthesis.

Actinomyces sp. are Gram-positive, facultatively anaerobic or microaerophilic rods. They are among the earliest colonizers of the dental biofilm and participate in the initial stages of plaque development through strong adhesion to the acquired pellicle and coaggregation with other oral microorganisms.^[22] Our findings demonstrate a significant increase in Actinomyces sp. in patients presenting with black stain, rising from three in the control group to ten in the black stain group. This observation corroborates earlier studies reporting the frequent detection of Actinomyces sp. in black stain plaque.^{[3,5,11,23-25]} Members of the Actinomyces are common residents of supragingival plaque. Some strains produce hydrogen sulfide, which can react with iron derived from saliva or gingival fluid to form ferric sulfide.^[9]Actinomyces sp. are considered important members of the oral biofilm community, where their metabolic activity may contribute to maintaining ecological balance and influencing plaque characteristics associated with black stain formation.

Treponema species showed no significant difference in abundance between children with and without black stain. These motile, Gram-negative spirochetes are associated with periodontal disease due to their proteolytic activity, tissue invasiveness and ability to evade the host immune response.^[26] Consistent with our findings, Treponema sp. was also detected in the studies conducted by Li et al.^[11]Treponema denticola produces volatile sulfur compounds (VSCs), such as hydrogen sulfide and methyl mercaptan^[26], which not only contribute to halitosis but may participate in the formation of iron sulfide pigments characteristic of black stains. Interactions between Treponema and other biofilm members may facilitate nutrient exchange and influence the redox balance within the dental plaque.

Streptococcus sp., which are dominant early colonizers involved in biofilm initiation and carbohydrate metabolism, showed decreased relative abundance in black stain samples compared to controls, suggesting an ecological shift toward less acidogenic and more iron- or sulfur-metabolizing taxa. Our results are consistent with those of Slots et al.^[5], who reported lower levels of Streptococcus sp. in children with black stain, whereas Heinrich-Weltzien et al.^[27], and Li et al.^[11] found no significant difference between groups. Reid and Beeley proposed that the reduced caries incidence in individuals with black extrinsic stains may be related to the higher calcium and phosphate content of the stain biofilm.^[9] However, the hypothesis that the microbial composition of black stain alone accounts for the lower caries experience in affected children remains uncertain.

Li Yue et al. reported that Streptococcus, Neisseria, and Capnocytophaga were among the dominant genera in black stain samples.^[11] Similarly, in our study, Neisseria were also identified as predominant taxa. Hwang et al. and Zhang et al. also detected Neisseria sp. in children with black stain, whereas these bacteria were absent or less prevalent in children without discoloration.^[23,28]Neisseria sp. are Gram-negative, aerobic diplococci that act as early colonizers of the oral cavity. Moreover, hydrogen sulfide (H₂S) can be produced through cysteine metabolism, suggesting that Neisseria sp. may also be involved in the pigmentation processes associated with black stain formation.^[29]

Members of the order Burkholderiales have not been previously reported in studies of black stain. Burkholderia species are Gram-negative, aerobic rods recognized for their metabolic adaptability, biofilm formation and resistance to oxidative stress. Burkholderia sp. can produce siderophores that can mobilize and stabilize ferric ions.^[30]

In agreement with our findings, Hwang et al. reported that Selenomonas sp. were more abundant in children without black stain, suggesting that these bacteria may be associated with a non-pigmented, health-related oral biofilm.^[31]Selenomonas is a Gram-negative, anaerobic, motile bacterium commonly found in the subgingival of healthy individuals. It is generally regarded as a commensal microorganism frequently detected in mature supragingival biofilms, particularly near the gingival margin and interproximal sites. When present in moderate abundance, it is typically associated with biofilm maturation and ecological balance rather than pathology.^[32] Overall, the distribution of Selenomonas sp. appears consistent with their presence as commensal members of a stable oral biofilm community.

Eikenella corrodens and Veillonella sp. were detected in our study, with Eikenella showing no significant difference between children with and without black stain, while Veillonella was observed exclusively in the control group. In contrast to our findings, Hwang et al.^[28] reported the presence of Veillonella dispar and V. rodentium as positive candidates for black stain formation, whereas in our study, Veillonella sp. were predominant only in the control group. Eikenella corrodens is a microaerophilic, Gram-negative rod normally present in the oral cavity. Although usually part of mixed infections, it can occasionally cause serious infections independently, and its slow growth and CO₂ requirement may lead to under-recognition.^[33]Veillonella sp. are Gram-negative, obligate anaerobic cocci that metabolize lactate into weaker acids, contributing to pH balance and microbial diversity in oral biofilms.^[31] Their exclusive presence in the control samples may indicate reduced buffering capacity and a shift toward a less diverse microbiota in the black stain group.

Bacillus cereus was identified as the predominant species in one control sample. It is a Gram-positive, spore-forming rod widely distributed in the environment and frequently isolated from various foods. This opportunistic bacterium is best known for causing foodborne illness through the production of emetic and diarrheal toxins. Beyond its well-established pathogenic function, recent studies emphasize the diversity of its virulence factors, genetic determinants of toxin synthesis, and growing antimicrobial resistance.^[34]