<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//TaxonX//DTD Taxonomic Treatment Publishing DTD v0 20100105//EN" "https://foliamedica.bg/nlm/tax-treatment-NS0.dtd">
<article xmlns:tp="http://www.plazi.org/taxpub" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" article-type="research-article" xml:lang="en">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">87</journal-id>
      <journal-id journal-id-type="index">urn:lsid:arphahub.com:pub:A116C711-4C18-5A38-8F1E-5E97753A8A64</journal-id>
      <journal-title-group>
        <journal-title xml:lang="en">Folia Medica</journal-title>
        <abbrev-journal-title xml:lang="en">FM</abbrev-journal-title>
      </journal-title-group>
      <issn pub-type="ppub">0204-8043</issn>
      <issn pub-type="epub">1314-2143</issn>
      <publisher>
        <publisher-name>Plovdiv Medical University</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.3897/folmed.68.e177504</article-id>
      <article-id pub-id-type="publisher-id">177504</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Research Article</subject>
        </subj-group>
        <subj-group subj-group-type="scientific_subject">
          <subject>Molecular biology</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Analysis of microRNA-451 gene expression and its association with liver function tests in β-thalassemia major</article-title>
      </title-group>
      <contrib-group content-type="authors">
        <contrib contrib-type="author" corresp="yes">
          <name name-style="western">
            <surname>Kadhim</surname>
            <given-names>Sanaa Jasim</given-names>
          </name>
          <email xlink:type="simple">sanaajasim@ige.uobaghdad.edu.iq</email>
          <uri content-type="orcid">https://orcid.org/0000-0003-4955-4875</uri>
          <xref ref-type="aff" rid="A1">1</xref>
        </contrib>
        <contrib contrib-type="author" corresp="no">
          <name name-style="western">
            <surname>Khamis</surname>
            <given-names>Doaa Abood</given-names>
          </name>
          <xref ref-type="aff" rid="A1">1</xref>
        </contrib>
        <contrib contrib-type="author" corresp="no">
          <name name-style="western">
            <surname>Jasim</surname>
            <given-names>Hamsa Ahmed</given-names>
          </name>
          <uri content-type="orcid">https://orcid.org/0009-0005-6421-669X</uri>
          <xref ref-type="aff" rid="A1">1</xref>
        </contrib>
      </contrib-group>
      <aff id="A1">
        <label>1</label>
        <addr-line content-type="verbatim">Institute of Genetic Engineering and Biotechnology for Postgraduate Studies, University of Baghdad, Baghdad, Iraq</addr-line>
        <institution>Institute of Genetic Engineering and Biotechnology for Postgraduate Studies, University of Baghdad</institution>
        <addr-line content-type="city">Baghdad</addr-line>
        <country>Iraq</country>
        <uri content-type="ror">https://ror.org/007f1da21</uri>
      </aff>
      <author-notes>
        <fn fn-type="corresp">
          <p><bold>Corresponding author</bold>: Sanaa Jasim Kadhim, Institute of Genetic Engineering and Biotechnology for Postgraduate Studies, University of Baghdad, Baghdad, Iraq; Email: <email xlink:type="simple">sanaajasim@ige.uobaghdad.edu.iq</email></p>
        </fn>
      </author-notes>
      <pub-date pub-type="collection">
        <year>2026</year>
      </pub-date>
      <pub-date pub-type="epub">
        <day>20</day>
        <month>08</month>
        <year>2026</year>
      </pub-date>
      <volume>68</volume>
      <issue>4</issue>
      <elocation-id>e177504</elocation-id>
      <uri content-type="arpha" xlink:href="http://openbiodiv.net/91F36329-65E8-5F76-8025-4A7FBA2967CB">91F36329-65E8-5F76-8025-4A7FBA2967CB</uri>
      <history>
        <date date-type="received">
          <day>08</day>
          <month>11</month>
          <year>2025</year>
        </date>
        <date date-type="accepted">
          <day>08</day>
          <month>03</month>
          <year>2026</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Sanaa Jasim Kadhim, Doaa Abood Khamis, Hamsa Ahmed Jasim</copyright-statement>
        <license license-type="creative-commons-attribution" xlink:href="http://creativecommons.org/licenses/by/4.0/" xlink:type="simple">
          <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <abstract>
        <p>
          <bold>Abstract</bold>
        </p>
        <p><bold>Introduction</bold>: Major β-thalassemia is a severe hereditary anemia caused by defective β-globin production and characterized by a permanent transfusion requirement, which leads to an overload of systemic iron and subsequent liver dysfunction. MicroRNA-451 (<abbrev xlink:title="MicroRNA-451">miR-451</abbrev>) is an erythroid-specific microRNA that plays a critical role in erythropoiesis, oxidative stress regulation, and iron metabolism. Nevertheless, there is still insufficient research on the connection between β-thalassemia major and liver function.</p>
        <p><bold>Aim</bold>: The study aimed to evaluate the expression of <abbrev xlink:title="MicroRNA-451">miR-451</abbrev> in Iraqi patients with β-thalassemia major and correlate it with liver function parameters.</p>
        <p><bold>Materials and methods</bold>: This case-control study involved 50 patients diagnosed with β-thalassemia major and 50 healthy individuals serving as controls. Total RNA was extracted from whole blood samples, and the expression levels of <abbrev xlink:title="MicroRNA-451">miR-451</abbrev> were quantified using quantitative real-time PCR (<abbrev xlink:title="quantitative real-time PCR">qRT-PCR</abbrev>). U6 small nuclear RNA was utilized as the endogenous control for normalization. Hematological indices and liver function parameters, specifically ALT, AST, and total serum bilirubin, were assessed and analyzed statistically.</p>
        <p><bold>Results</bold>: The expression of <abbrev xlink:title="MicroRNA-451">miR-451</abbrev> was upregulated significantly in patients in comparison with the controls (≈260-fold increase). The patients had significantly lower levels of hemoglobin and elevated platelet counts (<italic>p</italic>≤0.05). The liver enzymes, ALT and AST, and the total serum bilirubin were significantly increased in the patient group (<italic>p</italic>≤0.01). This study found a positive association between the overexpression of <abbrev xlink:title="MicroRNA-451">miR-451</abbrev> and hepatic dysfunction markers.</p>
        <p><bold>Conclusion</bold>: In β-thalassemia major, <abbrev xlink:title="MicroRNA-451">miR-451</abbrev> is significantly upregulated, suggesting it could be a biomarker for disease severity and liver function.</p>
      </abstract>
      <kwd-group>
        <label>Keywords</label>
        <kwd>major β-thalassemia</kwd>
        <kwd>liver functions</kwd>
        <kwd>microRNA-451</kwd>
        <kwd>gene expression</kwd>
      </kwd-group>
    </article-meta>
    <notes>
      <sec sec-type="Citation" id="sec1">
        <title>Citation</title>
        <p>Kadhim SJ, Khamis DA, Jasim HA. Analysis of microRNA-451 gene expression and its association with liver function tests in β-thalassemia major. Folia Med (Plovdiv) 2026;68(4):е177504. <ext-link ext-link-type="doi" xlink:href="10.3897/folmed.68.e177504">doi: 10.3897/folmed.68.e177504</ext-link>.</p>
      </sec>
    </notes>
  </front>
  <body>
    <sec sec-type="Introduction" id="sec2">
      <title>Introduction</title>
      <p>Beta-thalassemia major is a severe hereditary anemia that requires frequent blood transfusions due to a lack of β-globin production brought on by a mutations in the <italic>HBB</italic> gene.‌<sup>[<xref ref-type="bibr" rid="B1">1</xref>,<xref ref-type="bibr" rid="B2">2</xref>]</sup> Persistent transfusion therapy causes systemic iron overload<sup>[<xref ref-type="bibr" rid="B3">3</xref>-<xref ref-type="bibr" rid="B5">5</xref>]</sup>, which damages hepatocellular structures and compromises the liver function (iron build-up damages hepatic enzymes)<sup>[<xref ref-type="bibr" rid="B6">6</xref>-<xref ref-type="bibr" rid="B8">8</xref>]</sup>.</p>
      <p>MicroRNAs (<abbrev xlink:title="MicroRNAs">miRNAs</abbrev>) are small (~22 nucleotides) non-coding RNAs that regulate genes post-transcriptionally.<sup>[<xref ref-type="bibr" rid="B9">9</xref>]</sup> By modulating the expression of genes related to erythropoiesis, hemoglobin synthesis, and cellular stress responses, they play a significant regulatory role in β-thalassemia major. One of the <abbrev xlink:title="MicroRNAs">miRNAs</abbrev> that is most readily expressed in erythroid cells, <abbrev xlink:title="MicroRNA-451">miR-451</abbrev>, is essential for iron metabolism, erythropoiesis, and oxidative stress regulation.<sup>[<xref ref-type="bibr" rid="B10">10</xref>-<xref ref-type="bibr" rid="B12">12</xref>]</sup></p>
      <p>Clinically, individuals with β-thalassemia or β-thalassemia/HbE have been found to have elevated plasma <abbrev xlink:title="MicroRNA-451">miR-451</abbrev> levels, which correlate with hemolysis and erythropoietin activity markers like reticulocyte and platelet counts. <sup>[<xref ref-type="bibr" rid="B13">13</xref>-<xref ref-type="bibr" rid="B15">15</xref>]</sup> Furthermore, <abbrev xlink:title="MicroRNA-451">miR-451</abbrev> may provide protection against the renal damage associated with β-thalassemia, hence enhancing its potential as a biomarker.<sup>[<xref ref-type="bibr" rid="B16">16</xref>]</sup> However, the association between the expression of <abbrev xlink:title="MicroRNA-451">miR-451</abbrev> and liver function parameters in patients with β-thalassemia major is still insufficiently examined, especially in Iraqi populations.</p>
    </sec>
    <sec sec-type="Aim" id="sec3">
      <title>Aim</title>
      <p>The objective of this study was to evaluate the levels of gene expression of <abbrev xlink:title="MicroRNA-451">miR-451</abbrev> in β-thalassemia major patients from Iraq and to investigate their link with liver function parameters.</p>
    </sec>
    <sec sec-type="materials|methods" id="sec4">
      <title>Materials and methods</title>
      <p>The research was carried out at the University of Baghdad’s Institute of Genetic Engineering and Biotechnology from February 2024 to February 2025. The samples for the study were provided by the laboratories at Yarmouk Hospital in Bagdad. The study used 100 blood samples, 50 from patients with major beta-thalassemia and 50 from healthy individuals without major beta-thalassemia or other disorders. Consultant hematologists diagnosed all of the patients.</p>
      <p>This study measured the hematological parameters, containing white blood cell count (<abbrev xlink:title="white blood cell count">WBC</abbrev>), hemoglobin (<abbrev xlink:title="hemoglobin">Hb</abbrev>), and platelet count, using an automated hematology analyzer. Liver function parameters (ALT, AST, and TSB) were determined using an automated biochemical analyzer.</p>
      <p>Total RNA was extracted from whole blood samples following the manufacturer’s protocol.<sup>[<xref ref-type="bibr" rid="B17">17</xref>]</sup> RNA concentration and purity were measured spectrophotometrically. cDNA Synthesis SuperMix (EasyScript , Cat No. E-003S, TransGen Biotech) and the One-Step gDNA Removal were used for synthesis of cDNA. The reaction of cDNA synthesis contained the following components: 10 μl of reaction mix, 1 μl of random primers, 1 μl of anchored oligo dT, 1 μl of genomic DNA remover, 1 μl of E-mix reverse transcriptase, 3 μl of RNase-free water, and 5 μl of total RNA. Thermal cycling consisted of an initial denaturation at 25°C for 10 min, reverse transcription at 42°C for 15 min, and enzyme inactivation at 85°C for 5 seconds.</p>
      <p>The resulting cDNA was prepared for subsequent RT-qPCR analysis. The primer sequences <bold>(Table <xref ref-type="table" rid="T1">1</xref>)</bold> used in this study were recommended by Macrogen Company, Korea, in a lyophilized form, where Nuclease Water (<abbrev xlink:title="Nuclease Water">NFW</abbrev>) was used to dissolve them. Thus, a 100 picomolar stock solution was obtained, and <abbrev xlink:title="Nuclease Water">NFW</abbrev> was added to achieve a concentration of 10 picomoles by preparing a work solution.<sup>[<xref ref-type="bibr" rid="B18">18</xref>]</sup></p>
      <table-wrap id="T1" position="float" orientation="portrait">
        <label>Table 1.</label>
        <caption>
          <p>Primers designed in the study </p>
        </caption>
        <table>
          <tbody>
            <tr>
              <td rowspan="1" colspan="1">
                <bold>Primer</bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>Sequence (5'→3' direction)</bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>Primer size bp</bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>References</bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>t°C</bold>
              </td>
            </tr>
            <tr>
              <td rowspan="1" colspan="5"><abbrev xlink:title="MicroRNA-451">miR-451</abbrev> (gene expression)</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">Forward</td>
              <td rowspan="1" colspan="1">AAACCGTTACCATTACTGAGTT</td>
              <td rowspan="1" colspan="1">21</td>
              <td rowspan="1" colspan="1">Designed</td>
              <td rowspan="2" colspan="1">60</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">miR U6 F.P.</td>
              <td rowspan="1" colspan="1">AGAGAAGATTAGCATGGCCCCT</td>
              <td rowspan="1" colspan="1">22</td>
              <td rowspan="1" colspan="1">19</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">miRNA-universe R.P.</td>
              <td rowspan="1" colspan="1">GCGAGCACAGAATTAATACGAC</td>
              <td rowspan="1" colspan="1">22</td>
              <td rowspan="1" colspan="1">20</td>
              <td rowspan="2" colspan="1">58</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">Universal R. transcription p</td>
              <td rowspan="1" colspan="1">GAGGTCCAGTTTTTTTTTTTTTTTVN</td>
              <td rowspan="1" colspan="1">26</td>
              <td rowspan="1" colspan="1">21</td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <p>The expression levels of <abbrev xlink:title="MicroRNA-451">miR-451</abbrev> and the endogenous control U6 were estimated using <abbrev xlink:title="quantitative real-time PCR">qRT-PCR</abbrev> with SYBR Green. The resulting data were then amplified and utilized to normalize the <abbrev xlink:title="MicroRNA-451">miR-451</abbrev> levels.<sup>[<xref ref-type="bibr" rid="B19">19</xref>]</sup></p>
      <p>The reaction was carried out with a volume of 20 μL, following the manufacturer’s instructions. The amount of Super Mix named TransStart® Top Green qPCR (Cat No. AQ131-01, TransGen Biotech Company, Beijing, China) needed to prepare the necessary amount for reactions was calculated to be 10 μL. A quantity of 3 μL of cDNA as a template, 1 μL each of the forward and reverse primers, and, finally, 5 μL of nuclease-free water were added to complete the final volume of the reaction.<sup>[<xref ref-type="bibr" rid="B20">20</xref>,<xref ref-type="bibr" rid="B21">21</xref>]</sup> The stages and temperature of gene expression are shown in <bold>Table <xref ref-type="table" rid="T2">2</xref></bold>. U6 are small nuclear RNA (<abbrev xlink:title="small nuclear RNA">snRNA</abbrev>) that act as a housekeeping gene. Gene expression levels were quantified for both patient and control groups using quantitative real-time PCR (<abbrev xlink:title="quantitative real-time PCR">qRT-PCR</abbrev>). Cycle threshold (<abbrev xlink:title="Cycle threshold">Ct</abbrev>) values were determined for each target gene and a housekeeping gene. Data analysis was performed using two established methods: the Δ<abbrev xlink:title="Cycle threshold">Ct</abbrev> method and the ΔΔ<abbrev xlink:title="Cycle threshold">Ct</abbrev> method for fold-change calculation.<sup>[<xref ref-type="bibr" rid="B22">22</xref>,<xref ref-type="bibr" rid="B23">23</xref>]</sup></p>
      <table-wrap id="T2" position="float" orientation="portrait">
        <label>Table 2.</label>
        <caption>
          <p>Stages and temperatures of qRT PCR for U6 and miRNA-451 genes</p>
        </caption>
        <table>
          <tbody>
            <tr>
              <td rowspan="1" colspan="1">
                <bold>Stage</bold>
              </td>
              <td rowspan="1" colspan="1"/>
              <td rowspan="1" colspan="1">
                <bold>Temperature °C</bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>Time  (seconds)</bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>Cycle</bold>
              </td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">Stage 1</td>
              <td rowspan="1" colspan="1">Denaturation</td>
              <td rowspan="1" colspan="1">94</td>
              <td rowspan="1" colspan="1">60</td>
              <td rowspan="1" colspan="1">1</td>
            </tr>
            <tr>
              <td rowspan="3" colspan="1">Stage 2</td>
              <td rowspan="1" colspan="1">Denaturation</td>
              <td rowspan="1" colspan="1">94</td>
              <td rowspan="1" colspan="1">5</td>
              <td rowspan="3" colspan="1">35</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">Annealing</td>
              <td rowspan="1" colspan="1">58</td>
              <td rowspan="1" colspan="1">15</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">Extension</td>
              <td rowspan="1" colspan="1">72</td>
              <td rowspan="1" colspan="1">20</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">Stage 3</td>
              <td rowspan="1" colspan="1">Dissociation</td>
              <td rowspan="1" colspan="1">65–95</td>
              <td rowspan="1" colspan="1">1</td>
              <td rowspan="1" colspan="1">1</td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <p>The SAS software (version 9.6) was used in the statistical analysis. Data were expressed as mean ± standard error (<abbrev xlink:title="standard error">SE</abbrev>). Patients and controls differences were assessed using t-tests (independent sample). The statistically significant was signed as <italic>p</italic>-value ≤0.05.<sup>[<xref ref-type="bibr" rid="B24">24</xref>]</sup></p>
    </sec>
    <sec sec-type="Results" id="sec5">
      <title>Results</title>
      <p><bold>Table <xref ref-type="table" rid="T3">3</xref></bold> shows the distribution of study samples by <abbrev xlink:title="white blood cell count">WBC</abbrev>, <abbrev xlink:title="hemoglobin">Hb</abbrev>, and platelets in major β-thalassemia patients and control groups.</p>
      <table-wrap id="T3" position="float" orientation="portrait">
        <label>Table 3.</label>
        <caption>
          <p>Distribution of study samples by <abbrev xlink:title="white blood cell count">WBC</abbrev>, <abbrev xlink:title="hemoglobin">Hb</abbrev>, and platelets in major β-thalassemia patients and control groups</p>
        </caption>
        <table>
          <tbody>
            <tr>
              <td rowspan="1" colspan="1">
                <bold>Groups</bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold><abbrev xlink:title="white blood cell count">WBC</abbrev> Mean ± <abbrev xlink:title="standard error">SE</abbrev></bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold><abbrev xlink:title="hemoglobin">Hb</abbrev> Mean ± <abbrev xlink:title="standard error">SE</abbrev></bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>Platelets Mean ± <abbrev xlink:title="standard error">SE</abbrev></bold>
              </td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">Control</td>
              <td rowspan="1" colspan="1">7.13±0.23</td>
              <td rowspan="1" colspan="1">14.29±0.10</td>
              <td rowspan="1" colspan="1">253.6±7.85</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">Patients</td>
              <td rowspan="1" colspan="1">7.90±0.27</td>
              <td rowspan="1" colspan="1">10.68±0.19</td>
              <td rowspan="1" colspan="1">424.2±114.9</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">T-test</td>
              <td rowspan="1" colspan="1">−2.147</td>
              <td rowspan="1" colspan="1">16.035</td>
              <td rowspan="1" colspan="1">−1.481</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1"><italic>p</italic>-value</td>
              <td rowspan="1" colspan="1">0.060 NS</td>
              <td rowspan="1" colspan="1">0.017<sup>*</sup></td>
              <td rowspan="1" colspan="1">0.011<sup>*</sup></td>
            </tr>
          </tbody>
        </table>
        <table-wrap-foot>
          <fn>
            <p><italic>p</italic><bold>˃</bold>0.05=not significant, <italic>p</italic>≤0.05=significant</p>
          </fn>
        </table-wrap-foot>
      </table-wrap>
      <p>While the mean <abbrev xlink:title="white blood cell count">WBC</abbrev> count was only slightly higher in patients than controls without reaching statistical significance (<italic>p</italic>=0.060), mean hemoglobin (<abbrev xlink:title="hemoglobin">Hb</abbrev>) was markedly and significantly reduced in patients compared to controls (<italic>p</italic>=0.017). Furthermore, platelet count was significantly higher in patients than in the control group (<italic>p</italic>=0.011).</p>
      <p><bold>Table <xref ref-type="table" rid="T4">4</xref></bold> shows how study samples were distributed in patients and control groups based on ALT, AST, and TSB levels. Patients’ ALT levels were significantly higher than those of controls (<italic>p</italic>=0.0001). AST levels were significantly higher in patients than in controls (<italic>p</italic>=0.0001). TSB levels were significantly higher in patients compared to controls (<italic>p</italic>=0.0001).</p>
      <table-wrap id="T4" position="float" orientation="portrait">
        <label>Table 4.</label>
        <caption>
          <p>Distribution of study samples by ALT, AST, and TSB in major β-thalassemia patients and control groups</p>
        </caption>
        <table>
          <tbody>
            <tr>
              <td rowspan="1" colspan="1">
                <bold>Groups</bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>ALT Mean ± <abbrev xlink:title="standard error">SE</abbrev></bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>AST Mean ± <abbrev xlink:title="standard error">SE</abbrev></bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>TSB Mean ± <abbrev xlink:title="standard error">SE</abbrev></bold>
              </td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">Control</td>
              <td rowspan="1" colspan="1">19.24±0.82</td>
              <td rowspan="1" colspan="1">21.52±0.79</td>
              <td rowspan="1" colspan="1">0.40±0.02</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">Patients</td>
              <td rowspan="1" colspan="1">23.60±2.88</td>
              <td rowspan="1" colspan="1">31.70±3.45</td>
              <td rowspan="1" colspan="1">0.81±1.29</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">T-test</td>
              <td rowspan="1" colspan="1">−1.45</td>
              <td rowspan="1" colspan="1">−2.87</td>
              <td rowspan="1" colspan="1">−3.137</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1"><italic>P</italic>-value</td>
              <td rowspan="1" colspan="1">0.0001<sup>**</sup></td>
              <td rowspan="1" colspan="1">0.0001<sup>**</sup></td>
              <td rowspan="1" colspan="1">0.0001<sup>**</sup></td>
            </tr>
          </tbody>
        </table>
        <table-wrap-foot>
          <fn>
            <p><sup>**</sup><italic>p</italic>≤0.01=highly significant</p>
          </fn>
        </table-wrap-foot>
      </table-wrap>
      <sec sec-type="Molecular study" id="sec6">
        <title>Molecular study</title>
        <sec sec-type="Comparison miRNA-451 gene expression between study groups" id="sec7">
          <title>
            <italic>Comparison miRNA-451 gene expression between study groups</italic>
          </title>
          <p><bold>Table <xref ref-type="table" rid="T5">5</xref></bold> compares the expression of miRNA-451 between patients and control groups using the ΔΔ<abbrev xlink:title="Cycle threshold">Ct</abbrev> method. In the control group, the mean <abbrev xlink:title="Cycle threshold">Ct</abbrev> of miRNA-451 was 36.91, while in the patient group, the mean <abbrev xlink:title="Cycle threshold">Ct</abbrev> of miRNA-451 was 28.65, showing markedly lower <abbrev xlink:title="Cycle threshold">Ct</abbrev> compared to controls and indicating higher expression. The relative expression (2<sup>-ΔΔ<abbrev xlink:title="Cycle threshold">Ct</abbrev></sup>) reached ~250, which is higher than in the control group. This clearly shows that thalassemia patients have much higher miRNA-451 levels than healthy controls.</p>
          <table-wrap id="T5" position="float" orientation="portrait">
            <label>Table 5.</label>
            <caption>
              <p>Comparison of miRNA-451 gene expressions between study groups</p>
            </caption>
            <table>
              <tbody>
                <tr>
                  <td rowspan="1" colspan="1">
                    <bold>Group</bold>
                  </td>
                  <td rowspan="1" colspan="1">
                    <bold>Mean <abbrev xlink:title="Cycle threshold">Ct</abbrev> MiRNA-451</bold>
                  </td>
                  <td rowspan="1" colspan="1">
                    <bold>Mean <abbrev xlink:title="Cycle threshold">Ct</abbrev> U6 gene</bold>
                  </td>
                  <td rowspan="1" colspan="1">
                    <bold>Δct</bold>
                  </td>
                  <td rowspan="1" colspan="1">
                    <bold>Δct calibration</bold>
                  </td>
                  <td rowspan="1" colspan="1">
                    <bold>ΔΔct</bold>
                  </td>
                  <td rowspan="1" colspan="1">
                    <bold>2<sup>-ΔΔct</sup></bold>
                  </td>
                  <td rowspan="1" colspan="1">
                    <bold>Experimental/ control group</bold>
                  </td>
                  <td rowspan="1" colspan="1">
                    <bold>Fold change</bold>
                  </td>
                </tr>
                <tr>
                  <td rowspan="1" colspan="1">Control</td>
                  <td rowspan="1" colspan="1">36.91</td>
                  <td rowspan="1" colspan="1">23.25</td>
                  <td rowspan="1" colspan="1">13.66</td>
                  <td rowspan="1" colspan="1">14.6</td>
                  <td rowspan="1" colspan="1">−0.94</td>
                  <td rowspan="1" colspan="1">1.918</td>
                  <td rowspan="1" colspan="1">1.918/1.918</td>
                  <td rowspan="1" colspan="1">1</td>
                </tr>
                <tr>
                  <td rowspan="1" colspan="1">Patient</td>
                  <td rowspan="1" colspan="1">28.65</td>
                  <td rowspan="1" colspan="1">23.00</td>
                  <td rowspan="1" colspan="1">5.64</td>
                  <td rowspan="1" colspan="1">14.6</td>
                  <td rowspan="1" colspan="1">−8.96</td>
                  <td rowspan="1" colspan="1">497.99</td>
                  <td rowspan="1" colspan="1">497.99/1.918</td>
                  <td rowspan="1" colspan="1">259.64</td>
                </tr>
              </tbody>
            </table>
          </table-wrap>
        </sec>
      </sec>
    </sec>
    <sec sec-type="Discussion" id="sec8">
      <title>Discussion</title>
      <p>The significant reduction in <abbrev xlink:title="hemoglobin">Hb</abbrev> among patients reflects the chronic anemia associated with thalassemia, which is caused by ineffective erythropoiesis and accelerated hemolysis. These findings are consistent with those of Cappellini et al. and Bajwa, who found persistently low <abbrev xlink:title="hemoglobin">Hb</abbrev> levels in thalassemia patients, necessitating frequent blood transfusions.<sup>[<xref ref-type="bibr" rid="B25">25</xref>,<xref ref-type="bibr" rid="B26">26</xref>]</sup></p>
      <p>The fact that there were no significant differences between the two groups (patients and controls) suggests that thalassemia has a less direct effect on <abbrev xlink:title="white blood cell count">WBC</abbrev> count. However, some studies, such as Weatherall’s<sup>[<xref ref-type="bibr" rid="B27">27</xref>]</sup>, have found that recurrent infections or transfusion-related complications can occasionally affect <abbrev xlink:title="white blood cell count">WBC</abbrev> levels, though this was not observed in the current cohort.</p>
      <p>Patients’ platelet counts were found to be significantly elevated. This could be due to hypersplenism or, more commonly, a splenectomy, which is common in thalassemia patients to reduce transfusion needs. The current study supported the findings of Khawaji et al.<sup>[<xref ref-type="bibr" rid="B28">28</xref>]</sup>, who found elevated levels of platelet count. Taher et al.<sup>[<xref ref-type="bibr" rid="B29">29</xref>]</sup> have extensively documented elevated platelet counts following splenectomy, which are associated with an increased risk of thromboembolic events.</p>
      <p>The significant increase in liver enzymes and bilirubin suggests hepatic stress and potential hepatocellular injury. The current study supported the findings of Bashi and Fathi<sup>[<xref ref-type="bibr" rid="B30">30</xref>]</sup> and Luaibi and Mohammed<sup>[<xref ref-type="bibr" rid="B31">31</xref>,<xref ref-type="bibr" rid="B32">32</xref>]</sup>. These abnormalities are most likely the result of iron overload from repeated transfusions, as well as ongoing hemolysis. Borgna-Pignatti et al.<sup>[<xref ref-type="bibr" rid="B33">33</xref>]</sup> found that iron deposition in the liver is a major complication in thalassemia, frequently resulting in hepatic dysfunction and elevated transaminases. Elevated bilirubin levels contribute to the occurrence of enhanced hemolysis in these patients.</p>
      <p>According to the current study, thalassemia patients significantly overexpressed miRNA-451 compared to the control group. One of the most common erythroid-specific microRNAs is miRNA-451. It is necessary for controlling erythroid differentiation, red blood cell maturation, and oxidative stress defense. According to previous research by Papapetrou et al., miRNA-451 expression increases during erythropoiesis and is required for final red cell formation.‌<sup>[<xref ref-type="bibr" rid="B34">34</xref>]</sup> This upregulation is consistent with that study. Thalassemia is characterized by elevated oxidative stress from free α-globin chains and inefficient erythropoiesis. miRNA-451 overexpression in patients may be a compensatory strategy to improve erythroid maturation and prevent oxidative damage. Mustafa et al. found that miRNA-451 is elevated in red blood cells during oxidative stress, which is consistent with this.<sup>[<xref ref-type="bibr" rid="B35">35</xref>]</sup></p>
      <p>Elevated miRNA-451 levels in thalassemia could serve as a biomarker for hemolysis and erythroid activity. Numerous studies, including Wang et al.’s study from 2025, have suggested that miRNA-451 could be used as a predictive and diagnostic marker for hematological diseases such as sickle cell anemia and thalassemia.<sup>[<xref ref-type="bibr" rid="B36">36</xref>]</sup> The patients with thalassemia showed a significant (~260-fold) increase in miRNA-451 expression, indicating that the gene may play a role in the illness’s pathogenesis. Chronic overexpression may be a compensatory response to oxidative stress and anemia, but it could also indicate a disruption in erythropoiesis-regulating circuits.<sup>[<xref ref-type="bibr" rid="B37">37</xref>]</sup></p>
    </sec>
    <sec sec-type="Limitations" id="sec9">
      <title>Limitations</title>
      <p>There are several limitations to this study. Serum ferritin or liver iron concentration as iron accumulation parameters were not directly measured, and the sample size was small. Furthermore, causal interpretation is limited by the cross-sectional design. Large-scale, multicenter research is required to confirm these findings.</p>
    </sec>
    <sec sec-type="Conclusion" id="sec10">
      <title>Conclusion</title>
      <p>The patients’ hematological profile revealed a significant decrease in hemoglobin, indicating anemia, and a significantly increased level of platelets, indicating reactive thrombocytosis. The white blood cell count was slightly higher in comparison to the control group, but the difference was not statistically significant.</p>
      <p>The findings indicate that these patients may have hepatic stress and hepatocellular injury, possibly as a result of iron overload from chronic transfusion therapy and ongoing hemolysis. Increased bilirubin levels also indicate increased hemolysis, emphasizing the importance of closely monitoring liver function and effectively managing iron in thalassemia patients.</p>
      <p>According to the study, miRNA-451 is significantly upregulated in thalassemia patients compared to controls, which is consistent with its established role in regulating oxidative stress and erythropoiesis. This suggests that miRNA-451 could be a biological indicator of disease severity.</p>
    </sec>
  </body>
  <back>
    <ref-list>
      <title>References</title>
      <ref id="B1">
        <label>1.</label>
        <mixed-citation>Jasim MS, Hasan BQ. The role of hepcidin gene polymorphism (rs10421768 A˃G and rs1173345431C&gt;T) on β-thalassemia major in Iraqi patients. Iraqi J Biotechnol 2024;23(3):100–14.</mixed-citation>
      </ref>
      <ref id="B2">
        <label>2.</label>
        <mixed-citation>Adnan Khalaf M, Hasan ABQ, Qassim Mohammed H, et al. Alpha-hemoglobin stabilizing protein gene polymorphism (rs4499252 A/G) and its association with beta-thalassemia major in Iraqi patients. Arch Razi Inst 2022;77(3):1033–9.</mixed-citation>
      </ref>
      <ref id="B3">
        <label>3.</label>
        <mixed-citation>Mohammed SJ, Al-Lami F, Hussein MQ. Electrocardiographic changes among beta-thalassemic major patients in Ibn Al-Baladi thalassemia center-Baghdad. AL-Kindy Coll Med J 2013;9(1):36–41.</mixed-citation>
      </ref>
      <ref id="B4">
        <label>4.</label>
        <mixed-citation>Zainal IG, AL-Shaikle MK, Kadim SAA. A study of some biochemical parameters in patients with β- thalassemia. Baghdad Sci J 2008; 5(3):416–22.</mixed-citation>
      </ref>
      <ref id="B5">
        <label>5.</label>
        <mixed-citation>Jawad Kadhim A, Dhafir El-Yaseen H, Mohammed Jawad A. Correlation of Klotho protein with troponin-i as a marker of myocardial damage in Iraqi beta-thalassemia major patients. Rep Biochem Mol Biol 2024;13(2):154–8.</mixed-citation>
      </ref>
      <ref id="B6">
        <label>6.</label>
        <mixed-citation>Li M, Tang Y, Wu L, et al. The hepatocyte-specific HNF4α/miR-122 pathway contributes to iron overload-mediated hepatic inflammation. Blood 2017;130(8):1041–51.</mixed-citation>
      </ref>
      <ref id="B7">
        <label>7.</label>
        <mixed-citation>Ahmed HM, Georgy DB, Meabed MH, et al. The association between plasma microRNA-451 expression levels and chronic kidney disease in children with β-thalassemia major. Iran J Kidney Dis 2022;16(3):188–94.</mixed-citation>
      </ref>
      <ref id="B8">
        <label>8.</label>
        <mixed-citation>Keith J, Christakopoulos GE, Fernandez AG, et al. Loss of miR-144/451 alleviates β-thalassemia by stimulating ULK1-mediated autophagy of free α-globin. Blood 2023;142(10):918–32.</mixed-citation>
      </ref>
      <ref id="B9">
        <label>9.</label>
        <mixed-citation>Abdulameer H, Kandala NJ. Evaluation of plasma-microRNA320 level among colorectal cancer Iraqi patients. Iraqi J Sci 2023;64(3):1142–50.</mixed-citation>
      </ref>
      <ref id="B10">
        <label>10.</label>
        <mixed-citation>Wang F, Ling L, Yu D. MicroRNAs in β-thalassemia. Am J Med Sci 2021;362(1):5–12.</mixed-citation>
      </ref>
      <ref id="B11">
        <label>11.</label>
        <mixed-citation>Obeidi N, Pourfathollah AA, Soleimani M, et al. The effect of Mir-451 upregulation on erythroid lineage differentiation of murine embryonic stem cells. Cell J 2016;18(2):165–78.</mixed-citation>
      </ref>
      <ref id="B12">
        <label>12.</label>
        <mixed-citation>Talib EQ, Taha GI. Involvement of interlukin-17A (IL-17A) gene polymorphism and interlukin-23 (IL-23) level in the development of peri-implantitis. BDJ Open 2024;10:12.</mixed-citation>
      </ref>
      <ref id="B13">
        <label>13.</label>
        <mixed-citation>Ling L, Wang F, Li Y, et al. Depletion of miR-144/451 alleviates anemia in β-thalassemic mice. Blood Adv 2024;8(10):2565–70.</mixed-citation>
      </ref>
      <ref id="B14">
        <label>14.</label>
        <mixed-citation>Leecharoenkiat K, Tanaka Y, Harada Y, et al. Plasma microRNA-451 as a novel hemolytic marker for β0-thalassemia/HbE disease. Mol Med Rep 2017;15(5):2495–502.</mixed-citation>
      </ref>
      <ref id="B15">
        <label>15.</label>
        <mixed-citation>Taha GI, Talib EQ, Abed FB, et al. A review of microbial pathogens and diagnostic techniques in children’s oral health. Sri Lanka J Child Health 2024;53(4).</mixed-citation>
      </ref>
      <ref id="B16">
        <label>16.</label>
        <mixed-citation>Svasti S, Masaki S, Penglong T, et al. Expression of microRNA-451 in normal and thalassemic erythropoiesis. Ann Hematol 2010;89(10):953–8.</mixed-citation>
      </ref>
      <ref id="B17">
        <label>17.</label>
        <mixed-citation>Abdulhassn ML, Al-Khafaji HMAH, Mohammed MQ. Assessment of the TGF-β gene and its target miR-1908-5p gene expression and its role in the treatment of beta-thalassemia in Iraqi patients. Iraqi J Hematol 2025;14:101–8.</mixed-citation>
      </ref>
      <ref id="B18">
        <label>18.</label>
        <mixed-citation>Faris AZ, Sadoon HA, Qasim MM, et al. The role of CD279 and CD274 gene polymorphisms in Iraqi patients with multiple sclerosis by using real-time qPCR HRM technique. Res J Biotechnol 2024;19:11.</mixed-citation>
      </ref>
      <ref id="B19">
        <label>19.</label>
        <mixed-citation>Mohammed MQ, Ali AM, Alwan AH, et al. Investigation role of toll-like receptor-9 gene and miR-155 expression levels in acute myeloid leukemia via quantitative real-time PCR. Asian Pac J Cancer Prev 2025;26:1599–606.</mixed-citation>
      </ref>
      <ref id="B20">
        <label>20.</label>
        <mixed-citation>Hasan MJ, Bakheet MM, Ali HH, et al. Dual role of miR-150 in colorectal cancer progression: a quantitative real-time PCR study. Al-Rafidain J Med Sci 2025;8:221–9.</mixed-citation>
      </ref>
      <ref id="B21">
        <label>21.</label>
        <mixed-citation>Muhammed HJ, Al-Attar MM, Shubrem ZF, et al. Quantitative real-time PCR analysis of circulating MicroRNA levels in blood samples from pediatric patients with epilepsy. Gene Rep 2025;39:102214.</mixed-citation>
      </ref>
      <ref id="B22">
        <label>22.</label>
        <mixed-citation>Hassain AS, Al-Khafaji HMAH, Mohammed MQ. The role of miRNA-4516 in regulating Bruton’s tyrosine kinase expression and colorectal cancer progression in a sample of Iraqi population. J Biol Res 2025;98:12987.</mixed-citation>
      </ref>
      <ref id="B23">
        <label>23.</label>
        <mixed-citation>Al-Kafagi HMAA, Hussein NNA, Mohammed MQ, et al. The correlation between gene expression of growth differentiation factor 9B (GDF9B) gene and miR-378-5p in infertile women. Iraqi J Sci 2025;66(4):1560–9.</mixed-citation>
      </ref>
      <ref id="B24">
        <label>24.</label>
        <mixed-citation>Statistical Analysis System. Version 9.6. Cary, NC, USA: SAS Institute Inc.; 2018.</mixed-citation>
      </ref>
      <ref id="B25">
        <label>25.</label>
        <mixed-citation>Cappellini MD, Viprakasit V, Taher AT, et al. A phase 3 trial of luspatercept in patients with transfusion-dependent β-thalassemia. N Engl J Med 2020;382(13):1219–31.</mixed-citation>
      </ref>
      <ref id="B26">
        <label>26.</label>
        <mixed-citation>Bajwa H, Basit H. Thalassemia. In: StatPearls [Internet]. Treasure Island (FL): StatPearls Publishing; 2025 [cited 2025 Jan 27].</mixed-citation>
      </ref>
      <ref id="B27">
        <label>27.</label>
        <mixed-citation>Weatherall DJ. The evolving spectrum of the epidemiology of thalassemia. Hematol Oncol Clin North Am 2018;32(2):165–75.</mixed-citation>
      </ref>
      <ref id="B28">
        <label>28.</label>
        <mixed-citation>Khawaji MM, Hazzazi AA, Ageeli MH, et al. Clinical and hematological features among β-thalassemia major patients in Jazan region: A hospital-based study. J Family Med Prim Care 2020;9(1):412–7.</mixed-citation>
      </ref>
      <ref id="B29">
        <label>29.</label>
        <mixed-citation>Taher AT, Weatherall DJ, Cappellini MD. Thalassaemia. Lancet 2018; 391(10116):155-67.</mixed-citation>
      </ref>
      <ref id="B30">
        <label>30.</label>
        <mixed-citation>Dallal Bashi AY, Fathi FH. Evaluation of hepatic enzymes in major β-thalassemic patients using deferasirox. Iraqi J Pharm Sci 2022;31(2):237–43.</mixed-citation>
      </ref>
      <ref id="B31">
        <label>31.</label>
        <mixed-citation>Luaibi HA, Mohammed BJ. Demographic and biochemical study of beta thalassemia major associated with liver and pancreas disorders in adult sample of patients from Baghdad province. Iraqi J Biotechnol 2024;23(2):98–104.</mixed-citation>
      </ref>
      <ref id="B32">
        <label>32.</label>
        <mixed-citation>Luaibi HA, Mohammed BJ. Relationship of TNFα-238 G/A (rs 361525) genotypes with TNFα gene expression in liver and pancreas disorders in sample of beta thalassemia major adult Iraqi patients. Hum Antibodies 2024;32(2):67–74.</mixed-citation>
      </ref>
      <ref id="B33">
        <label>33.</label>
        <mixed-citation>Borgna-Pignatti C, Garani MC, Forni GL, et al. Hepatocellular carcinoma in thalassaemia: an update of the Italian Registry. Br J Haematol 2014;167(1):121–6.</mixed-citation>
      </ref>
      <ref id="B34">
        <label>34.</label>
        <mixed-citation>Papapetrou EP, Lee G, Malani N, et al. Genomic safe harbors permit high β-globin transgene expression in thalassemia induced pluripotent stem cells. Nat Biotechnol 2011; 29(1):73–8.</mixed-citation>
      </ref>
      <ref id="B35">
        <label>35.</label>
        <mixed-citation>Mustafa N, Ghani A, Kakar U, et al. Hematological and biochemical status of beta thalassemia in Pakistani and Afghani patients of Quetta city, Pakistan. Int J Biol Biotechnol 2019;15(6):283–9.</mixed-citation>
      </ref>
      <ref id="B36">
        <label>36.</label>
        <mixed-citation>Wang FX, Mu G, Yu ZH, et al. MiR-451 in inflammatory diseases: molecular mechanisms, biomarkers, and therapeutic applications-a comprehensive review beyond oncology. Curr Issues Mol Biol 2025;47(2):127.</mixed-citation>
      </ref>
      <ref id="B37">
        <label>37.</label>
        <mixed-citation>Rujito L, Wardana T, Mulyanto J, et al. Roles of microRNAs in thalassemia: Mechanisms, biomarkers, and therapeutic implications – a narrative review. J Res Clin Med 2025;13:34673.</mixed-citation>
      </ref>
    </ref-list>
    <sec sec-type="Additional information" id="sec11">
      <title>Additional information</title>
      <p>
        <bold>Ethical statement</bold>
      </p>
      <list list-type="bullet">
        <list-item>
          <p>The authors declared that no clinical trials were used in the present study.
</p>
        </list-item>
        <list-item>
          <p>The authors declared that no experiments on humans or human tissues were performed for the present study.
</p>
        </list-item>
        <list-item>
          <p>The authors declared that written informed consent was obtained from all participants before enrollment into this study.
</p>
        </list-item>
        <list-item>
          <p>The Research Ethics Committee of the University of Baghdad’s Institute of Genetic Engineering and Biotechnology reviewed the protocol of this study and granted an approval.
</p>
        </list-item>
        <list-item>
          <p>The authors declared that no experiments on animals were performed for the present study.
</p>
        </list-item>
        <list-item>
          <p>The authors declared that no commercially available immortalized human and animal cell lines were used in the present study.
</p>
        </list-item>
      </list>
      <p>
        <bold>Conflict of interest</bold>
      </p>
      <p>The authors have declared that no competing interests exist.</p>
      <p>
        <bold>Artificial Intelligence (AI) use</bold>
      </p>
      <p>The authors accept full responsibility for the content of the manuscript, including the disclosure of any use of AI. No AI tools were used in the preparation of this manuscript.</p>
      <p>
        <bold>Funding</bold>
      </p>
      <p>No funding was reported.</p>
      <p>
        <bold>Author contributions</bold>
      </p>
      <p>All authors have contributed equally.</p>
      <p>
        <bold>Author ORCIDs</bold>
      </p>
      <p>Hamsa Ahmed Jasim <ext-link xlink:href="https://orcid.org/0009-0005-6421-669X" ext-link-type="uri">0009-0005-6421-669X</ext-link></p>
      <p>
        <bold>Data availability</bold>
      </p>
      <p>All of the data that support the findings of this study are available in the main text.</p>
    </sec>
  </back>
</article>
