<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//TaxonX//DTD Taxonomic Treatment Publishing DTD v0 20100105//EN" "../../nlm/tax-treatment-NS0.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:tp="http://www.plazi.org/taxpub" article-type="research-article" dtd-version="3.0" xml:lang="en">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">87</journal-id>
      <journal-id journal-id-type="index">urn:lsid:arphahub.com:pub:A116C711-4C18-5A38-8F1E-5E97753A8A64</journal-id>
      <journal-title-group>
        <journal-title xml:lang="en">Folia Medica</journal-title>
        <abbrev-journal-title xml:lang="en">FM</abbrev-journal-title>
      </journal-title-group>
      <issn pub-type="ppub">0204-8043</issn>
      <issn pub-type="epub">1314-2143</issn>
      <publisher>
        <publisher-name>Plovdiv Medical University</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.3897/folmed.64.e66292</article-id>
      <article-id pub-id-type="publisher-id">66292</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Case Report</subject>
        </subj-group>
        <subj-group subj-group-type="scientific_subject">
          <subject>Clinical genetics</subject>
          <subject>Molecular biology</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>New deletion in <italic>LAMP2</italic> causing familial Danon disease. Effect of the X-chromosome inactivation</article-title>
      </title-group>
      <contrib-group content-type="authors">
        <contrib contrib-type="author" corresp="yes">
          <name name-style="western">
            <surname>Sivitskaya</surname>
            <given-names>Larysa</given-names>
          </name>
          <email xlink:type="simple">silarissa@yandex.ru</email>
          <uri content-type="orcid">https://orcid.org/0000-0001-6359-4967</uri>
          <xref ref-type="aff" rid="A1">1</xref>
        </contrib>
        <contrib contrib-type="author" corresp="no">
          <name name-style="western">
            <surname>Vaikhanskaya</surname>
            <given-names>Tatiyana</given-names>
          </name>
          <uri content-type="orcid">https://orcid.org/0000-0002-2127-8525</uri>
          <xref ref-type="aff" rid="A2">2</xref>
        </contrib>
        <contrib contrib-type="author" corresp="no">
          <name name-style="western">
            <surname>Danilenko</surname>
            <given-names>Nina</given-names>
          </name>
          <xref ref-type="aff" rid="A3">3</xref>
        </contrib>
        <contrib contrib-type="author" corresp="no">
          <name name-style="western">
            <surname>Liaudanski</surname>
            <given-names>Aleh</given-names>
          </name>
          <xref ref-type="aff" rid="A3">3</xref>
        </contrib>
        <contrib contrib-type="author" corresp="no">
          <name name-style="western">
            <surname>Davydenko</surname>
            <given-names>Oleg</given-names>
          </name>
          <xref ref-type="aff" rid="A3">3</xref>
        </contrib>
        <contrib contrib-type="author" corresp="no">
          <name name-style="western">
            <surname>Zhelev</surname>
            <given-names>Nikolai</given-names>
          </name>
          <uri content-type="orcid">https://orcid.org/0000-0002-5189-3975</uri>
          <xref ref-type="aff" rid="A4">4</xref>
          <xref ref-type="aff" rid="A5">5</xref>
        </contrib>
      </contrib-group>
      <aff id="A1">
        <label>1</label>
        <addr-line content-type="verbatim">Genomed Health Care Centre, Diagnostic Department, Warsaw, Poland</addr-line>
        <institution>Genomed Health Care Centre, Diagnostic Department</institution>
        <addr-line content-type="city">Warsaw</addr-line>
        <country>Poland</country>
      </aff>
      <aff id="A2">
        <label>2</label>
        <addr-line content-type="verbatim">Republican Scientific and Practical Center of Cardiology, Minsk, Belarus</addr-line>
        <institution>Republican Scientific and Practical Center of Cardiology</institution>
        <addr-line content-type="city">Minsk</addr-line>
        <country>Belarus</country>
      </aff>
      <aff id="A3">
        <label>3</label>
        <addr-line content-type="verbatim">Institute of Genetics and Cytology, National Academy of Sciences, Minsk, Belarus</addr-line>
        <institution>Institute of Genetics and Cytology, National Academy of Sciences</institution>
        <addr-line content-type="city">Minsk</addr-line>
        <country>Belarus</country>
      </aff>
      <aff id="A4">
        <label>4</label>
        <addr-line content-type="verbatim">University of Dundee, Dundee, United Kingdom</addr-line>
        <institution>University of Dundee</institution>
        <addr-line content-type="city">Dundee</addr-line>
        <country>United Kingdom</country>
      </aff>
      <aff id="A5">
        <label>5</label>
        <addr-line content-type="verbatim">Medical University of Plovdiv, Plovdiv, Bulgaria</addr-line>
        <institution>Medical University Plovdiv</institution>
        <addr-line content-type="city">Plovdiv</addr-line>
        <country>Bulgaria</country>
      </aff>
      <author-notes>
        <fn fn-type="corresp">
          <p>Corresponding author: Larysa Sivitskaya, Genomed Health Care Centre, Diagnostic Department, Warsaw, Poland; Email: <email xlink:type="simple">lsivitskaya@yahoo.com</email>; <email xlink:type="simple">Tel</email>.: +<email xlink:type="simple">375-293-88-52-59</email></p>
        </fn>
      </author-notes>
      <pub-date pub-type="collection">
        <year>2022</year>
      </pub-date>
      <pub-date pub-type="epub">
        <day>31</day>
        <month>10</month>
        <year>2022</year>
      </pub-date>
      <volume>64</volume>
      <issue>5</issue>
      <fpage>853</fpage>
      <lpage>862</lpage>
      <uri content-type="arpha" xlink:href="http://openbiodiv.net/9802D177-43F4-5F72-9FE5-82988812C8DF">9802D177-43F4-5F72-9FE5-82988812C8DF</uri>
      <history>
        <date date-type="received">
          <day>03</day>
          <month>04</month>
          <year>2021</year>
        </date>
        <date date-type="accepted">
          <day>22</day>
          <month>06</month>
          <year>2021</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>Larysa Sivitskaya, Tatiyana Vaikhanskaya, Nina Danilenko, Aleh Liaudanski, Oleg Davydenko, Nikolai Zhelev</copyright-statement>
        <license license-type="creative-commons-attribution" xlink:href="http://creativecommons.org/licenses/by/4.0/" xlink:type="simple">
          <license-p>This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.</license-p>
        </license>
      </permissions>
      <abstract>
        <label>Abstract</label>
        <p>Danon disease (<abbrev xlink:title="Danon disease" id="ABBRID0EHF">DD</abbrev>), a rare X-linked genetic illness with a poor prognosis, is caused by a mutation in the lysosome-associated membrane protein 2 gene (<italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EMF">LAMP2</abbrev></italic>). Three main clinical features of this pathology are cardiomyopathy, skeletal myopathy, and mental retardation. Most Danon disease mutations create premature stop codons resulting in the decrease or absence of <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0ERF">LAMP2</abbrev></italic> protein.</p>
        <p>The present case reports the frameshift variant c.190_191delАС in the <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EYF">LAMP2</abbrev></italic> in the family with sudden cardiac death history and three members with cardiomyopathy. The presenting phenotype in a female proband with c.190_191delАС was isolated dilated cardiomyopathy in her thirties whereas in two males, <abbrev xlink:title="Danon disease" id="ABBRID0E3F">DD</abbrev> presented as hypertrophic cardiomyopathy and mild skeletal myopathy since childhood. To examine the contribution of X-inactivation to cardiomyopathy onset we estimated the X-inactivation status in the heart tissue of the affected female. We observed the random pattern (66:34) with the proportion of cardiomyocytes expressing healthy <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EBG">LAMP2</abbrev></italic> allele reduced to 34%. Deletion c.190_191delАС has led to a complete loss of function <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EGG">LAMP2</abbrev></italic> due to a single copy of this gene in males. In a woman, cardiomyopathy developed because of both the <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0ELG">LAMP2</abbrev></italic> mutation and a decrease in the expression of a healthy allele in the heart.</p>
        <p>Based on the strong association of truncating <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0ESG">LAMP2</abbrev></italic> mutations with <abbrev xlink:title="Danon disease" id="ABBRID0EWG">DD</abbrev> and phenotypes in affected members, the variant c.190_191delАС was classified as pathogenic.</p>
      </abstract>
      <kwd-group>
        <label>Keywords</label>
        <kwd>cardiomyopathy</kwd>
        <kwd>chromosome X inactivation</kwd>
        <kwd>Danon disease</kwd>
        <kwd>
          <italic>LAMP2</italic>
        </kwd>
        <kwd>lysosome-associated membrane protein 2</kwd>
      </kwd-group>
    </article-meta>
  </front>
  <body>
    <sec sec-type="Introduction" id="SECID0EFH">
      <title>Introduction</title>
      <p>Danon disease (<abbrev xlink:title="Danon disease" id="ABBRID0ELH">DD</abbrev>), a rare X-linked genetic illness with poor prognosis, was described in 1981 by Danon. Three main clinical features of the pathology are cardiomyopathy, skeletal myopathy, and mental retardation.<sup>[<xref ref-type="bibr" rid="B1">1</xref>]</sup><abbrev xlink:title="Danon disease" id="ABBRID0EWH">DD</abbrev> is caused by loss-of-function mutations in the <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0E2H">LAMP2</abbrev></italic> gene (Xq24) that encodes for lysosome-associated membrane protein-2, lower levels of which causes autophagy disrupted. The clinical presentation is more problematic in males who are hemizygous for <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EBAAC">LAMP2</abbrev></italic>. Women are usually affected but tend to have a milder and more variable phenotype than males.<sup>[<xref ref-type="bibr" rid="B2">2</xref>]</sup></p>
      <p>The prevalence of <abbrev xlink:title="Danon disease" id="ABBRID0ENAAC">DD</abbrev> is unknown but is considered to be less than one case per million.<sup>[<xref ref-type="bibr" rid="B3">3</xref>,<xref ref-type="bibr" rid="B4">4</xref>]</sup> According to the study of 50 pediatric patients with HCM, two cases of Danon disease (4%) were found.<sup>[<xref ref-type="bibr" rid="B5">5</xref>]</sup> The estimated prevalence of 1%–6% in patients with unexplained left ventricular hypertrophy (<abbrev xlink:title="left ventricular hypertrophy" id="ABBRID0E6AAC">LVH</abbrev>) was reported.<sup>[<xref ref-type="bibr" rid="B6">6</xref>]</sup> The high prevalence of <abbrev xlink:title="Danon disease" id="ABBRID0EKBAC">DD</abbrev> (12%) was found in young female patients with non-ischemic heart failure.<sup>[<xref ref-type="bibr" rid="B7">7</xref>]</sup></p>
      <p>In this study, we present a detailed clinical report on familial cardiomyopathy resulting from mutation c.190_191delАС firstly identified in the <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EXBAC">LAMP2</abbrev></italic> gene. We compare cardiac phenotypes between family members and show the development of early cardiac dysfunction and hypertrophic cardiomyopathy in males. We demonstrate a critical decrease of healthy <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0E3BAC">LAMP2</abbrev></italic> allele expression in the female carrier heart due to X chromosome inactivation.</p>
    </sec>
    <sec sec-type="materials|methods" id="SECID0EACAC">
      <title>Materials and methods</title>
      <sec sec-type="Ethics statement" id="SECID0EECAC">
        <title>Ethics statement</title>
        <p>Informed consent was obtained from all participants and clinical surveillance and genetic investigations were performed in accordance with the recommendations of the local ethics committee of the Belarusian State Medical University and the Scientific Board of the Institute of Genetics and Cytology of the National Academy of Sciences.</p>
      </sec>
    </sec>
    <sec sec-type="Case report" id="SECID0EJCAC">
      <title>Case report</title>
      <p>
        <italic>a 34-year-old female patient with previous history of Caesarean section was admitted to the Scientific and Practical Center of Cardiology (Belarus) with symptoms of congestive heart failure (<abbrev xlink:title="heart failure" id="ABBRID0ERCAC">HF</abbrev>). During the last trimester of the her third pregnancy, she suffered from swelling, shortness of breath and weakness. Dilatation of the heart chambers and systolic left ventricular (<abbrev xlink:title="left ventricular" id="ABBRID0EVCAC">LV</abbrev>) dysfunction were established. Her electrocardiogram (<abbrev xlink:title="electrocardiogram" id="ABBRID0EZCAC">ECG</abbrev>) showed sinus tachycardia and pre-excitation with a positive delta wave in the inferior leads and negative T waves in the anterior leads. Chest X-ray revealed massive cardiomegaly. Transthoracic 2D-Echo study revealed global hypokinesia, severe <abbrev xlink:title="left ventricular" id="ABBRID0E4CAC">LV</abbrev> systolic dysfunction and an ejection fraction of 30%. Coronary angiography was normal. Diagnosis of peripartum cardiomyopathy was made and the patient received standard heart failure treatment.</italic>
      </p>
      <p>
        <italic>During the next few months after delivery despite the medical therapy, the patient developed progressive heart failure with symptoms consisting of decreased exercise capacity, tiredness, dyspnoea, orthopnoea, oedema, and palpitations. After 14 months, she was readmitted to the emergency department with acute heart failure, atrial and ventricular tachyarrhythmias. The patient ultimately underwent heart transplantation 5 weeks later.</italic>
      </p>
      <p><italic>The electrocardiogram showed atrial flutter, atypical left bundle branch block (<abbrev xlink:title="left bundle branch block" id="ABBRID0EKDAC">LBBB</abbrev>) with pseudo-infarction signs of Sodi-Pollares (abnormal QS in leads I, aVL, V5-V6)</italic><bold><italic>(Fig. 1А)</italic></bold> . <italic>Cardiovascular magnetic resonance imaging revealed biventricular dilatation and systolic dysfunction (15% ejection fraction of both ventricles), apex aneurysm with thrombosis, multiple areas of late enhancement with extensive diffuse mid-myocardial pattern contrasting delay and transmural fibrosis in the anterior and anterolateral <abbrev xlink:title="left ventricular" id="ABBRID0EUDAC">LV</abbrev> wall (calculated myocardial mass index 127 g/m<sup>2</sup>). Expansive fibrotic changes in the dilated left ventricle are shown in</italic><bold><italic>Figs 1B-E</italic></bold> .</p>
      <fig id="F1" position="float" orientation="portrait">
        <object-id content-type="arpha">30E10F9B-2CEC-5137-B7B5-51864B89666C</object-id>
        <label>Figure 1.</label>
        <caption>
          <p>Cardiac anomalies identified in the proband. <bold>А.</bold> Electrocardiogram of the proband demonstrating atrial flutter, atypical left bundle branch block with pseudo-infarction signs of Sodi-Pollares (abnormal QS in leads I, aVL, V5-V6) and Cabrera sign (notch on the ascending S wave in lead V4 with a duration of 40 ms); <bold>B.</bold> Cardiac MRI plan the 4-chamber cine on the long axis image shows aneurysmal bulging of left ventricular apex with thrombus; <bold>C.</bold> T1-native mapping with signs of apical aneurysm and thrombus 34×27 mm; <bold>D.</bold> Late-gadolinium enhancement imaging on the short axis indicates presence of midwall myocardial contrast delay pattern with extensive linear fibrosis of left ventricular free wall, anterio-inferio-lateralis and septal myocardial scarring (arrowheads); <bold>E.</bold> Tissue <abbrev xlink:title="left ventricular" id="ABBRID0EQEAC">LV</abbrev> characteristic: bull’s eye map image demonstrates late gadolinium enhancement (short axis, 16 segments; grade 0-100%) a diffuse pattern of intramural and transmural fibrosis in the apex, anterior and anterolateral <abbrev xlink:title="left ventricular" id="ABBRID0EUEAC">LV</abbrev> wall.</p>
        </caption>
        <graphic xlink:href="foliamedica-64-5-e66292-g001.jpg" position="float" orientation="portrait" xlink:type="simple" id="oo_763177.jpg">
          <uri content-type="original_file">https://binary.pensoft.net/fig/763177</uri>
        </graphic>
      </fig>
      <p><italic>The neuromuscular examination revealed no specific abnormalities, especially no muscle weakness. Pertinent laboratory parameters included elevated lactate dehydrogenase (420 U/l; normal range, 120–250 U/l), elevated N-terminal pro b-type natriuretic peptide (16766 pg/ml; normal range, 0–450 pg/ml), elevated aspartate transferase (279 U/l; normal range, 13–35 U/l) and elevated γ-glutamyl transpeptidase (99 U/l; normal range, 7–45 U/l). All other serum parameters were normal as well as creatine phosphokinase. Genetic evaluation and cascade screening were proposed to the proband in that the family history construction showed a sudden cardiac death of her mother at the age of 30 years</italic>.</p>
      <sec sec-type="Molecular genetic analyses" id="SECID0EBFAC">
        <title>Molecular genetic analyses</title>
        <sec sec-type="DNA and RNA isolation" id="SECID0EFFAC">
          <title>
            <italic>DNA and RNA isolation</italic>
          </title>
          <p>Genomic DNA from buccal cells was extracted by phenol/chloroform from all available family members and used for NGS and Sanger sequencing.</p>
          <p>To measure X-chromosome inactivation status in the heart muscle, we isolated genomic DNA from the left ventricle sample of proband II-2 obtained from heart transplantation. DNA was extracted with Tri-Reagent according to the protocol of Sigma-Aldrich (USA). Total RNA from the control and patient’s cardiac muscle was isolated using the Innu SPEED Tissue RNA Kit (Analytik Jena, Germany). RNA was reverse transcribed using ProtoScript II First Strand cDNA Synthesis Kit (New England Biolabs Inc.) and oligo-dT primers. RNA quality was analyzed by electrophoresis in 1% agarose gel and spectrophotometry.</p>
        </sec>
        <sec sec-type="DNA sequencing" id="SECID0EOFAC">
          <title>
            <italic>DNA sequencing</italic>
          </title>
          <p>We performed the NGS of the proband (II-2) using the TruSight Cardiomyopathy sequencing panel on the MiSeq System (Illumina Inc., USA). We estimated the quality control of raw NGS data with FASTQC, performed alignment using BWA against the reference genome NCBIbuild37 (UCSC hg19), generated the VCF with GATK4 HaplotypeCaller. Variants were annotated by ANNOVAR using dbSNP IDs, Exome Variant Server, The 1000 Genomes Browser, the Genome Aggregation Database, ClinVar and REVEL.</p>
          <p>The Sanger sequencing was performed for variant confirmation and family genotyping. The exon 3 of <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EZFAC">LAMP2</abbrev></italic> was amplified with designed primers (Supplemental Appendix 1) and FIREPol Master Mix (Solis BioDyne, Estonia), purified with ExS-Pure™ Enzymatic PCR purification kit (NimaGen B.V., The Netherlands) and directly sequenced using Big Dye Terminator v3.1 cycle sequencing kit and 3500 Genetic Analyzer (Applied Biosystems, USA).</p>
        </sec>
        <sec sec-type="XCI status measurement by the human androgen receptor (HUMARA) assay" id="SECID0E4FAC">
          <title>
            <italic>XCI status measurement by the human androgen receptor (HUMARA) assay</italic>
          </title>
          <p>XCI status was evaluated by the methylation of Hin6I sites in the androgen receptor gene (<abbrev xlink:title="androgen receptor" id="ABBRID0EGGAC">AR</abbrev>) in three independent experiments. This gene is reliably methylated when inactivated and correlated with X-chromosome inactivation. In brief, 2 mg DNA was digested with the methylation-sensitive endonuclease Hin6I in the final concentration 1U/nl (ThermoFisher, USA). Then the <abbrev xlink:title="androgen receptor" id="ABBRID0EKGAC">AR</abbrev> locus, containing (CAG)n repeat, was amplified both in digested and undigested DNA samples with primers, labeled with FAM (Primetech ALC, Belarus). The primer sequences and PCR-conditions were described previously.<sup>[<xref ref-type="bibr" rid="B8">8</xref>]</sup> PCR products were detected at 3500 Genetic Analyzer and visualized with the help of GeneMapper software (Applied Biosystems, USA). XCI status was estimated as the calculated ratio between peak areas of the <abbrev xlink:title="androgen receptor" id="ABBRID0EVGAC">AR</abbrev> alleles of digested and non-digested DNA. The same test was performed with the affected son’s DNA obtained from buccal epithelium.</p>
        </sec>
        <sec sec-type="Quantitative real-time RT-PCR" id="SECID0EZGAC">
          <title>
            <italic>Quantitative real-time RT-PCR</italic>
          </title>
          <p>To estimate the expression of healthy <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EDHAC">LAMP2</abbrev></italic> allele in the proband II-2, we designed TaqMan assay specific for c.190_191delАС (NM_001122606.1) using Beacon Designer software (Bio-Rad Inc., USA) (Supplementary data, Table 1S). The MIF and B2M were selected as endogenous reference genes for comparative analysis of gene expression.<sup>[<xref ref-type="bibr" rid="B9">9</xref>,<xref ref-type="bibr" rid="B10">10</xref>]</sup> For relative quantification of <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EPHAC">LAMP2</abbrev></italic> mRNA expression, we used RNA samples obtained from normal heart muscles of three females (40, 42, and 64 years old) as a control. Their tissue samples were taken during surgery for valve or septum correction. These women did not have dilated cardiomyopathy (<abbrev xlink:title="dilated cardiomyopathy" id="ABBRID0ETHAC">DCM</abbrev>).</p>
        </sec>
        <sec sec-type="Statistical analysis" id="SECID0EXHAC">
          <title>
            <italic>Statistical analysis</italic>
          </title>
          <p>Relative quantification of <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EBIAC">LAMP2</abbrev></italic> mRNA level between patient and controls was calculated by the ΔΔCt method.<sup>[<xref ref-type="bibr" rid="B11">11</xref>]</sup> Student’s t-test determined the statistical significance to have a value of <italic>p</italic>&lt;0.05, which was sufficiently significant.</p>
          <p>The statistical analysis was performed to assess whether the heterozygotes with strongly inactivated healthy allele tended to have earlier cardiomyopathy manifestation than heterozygotes with weak inactivation of a healthy allele. Published data of the XCI ratio in females with <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0ERIAC">LAMP2</abbrev></italic> mutations were used to calculate Pearson correlation coefficients. The statistical significance was assessed through a confidence interval.</p>
        </sec>
      </sec>
    </sec>
    <sec sec-type="Results" id="SECID0EVIAC">
      <title>Results</title>
      <sec sec-type="New truncating mutation c.190_191delAC identified in LAMP2 gene" id="SECID0EZIAC">
        <title>New truncating mutation c.190_191delAC identified in <italic>LAMP2</italic> gene</title>
        <p>To detect the genetic reason for dilated cardiomyopathy in the proband, we performed NGS with the TruSight Cardiomyopathy sequencing panel, harboured 174 genes. A 2bp-deletion c.190_191delАС was identified in exon 3 of the <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EGJAC">LAMP2</abbrev></italic> gene. It results in the frameshift, creating a premature stop codon at position 11 of the new reading frame, denoted p.Val64Asnfs*11. The total predicted length of truncated <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0ELJAC">LAMP2</abbrev></italic> protein is 74 amino-acid residues instead of 410. It means the protein lacks the transmembrane domain, cytosolic tail and most part of the luminal domain. Such rearrangement leads to loss of <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EQJAC">LAMP2</abbrev></italic> function.</p>
        <p>Family genotyping revealed that the proband’s two sons have inherited c.190_191delАС variant. It results in the total absence of the native protein and early clinical phenotype in the boys. The family pedigree is shown in <bold>Fig. 2</bold>.</p>
        <fig id="F2" position="float" orientation="portrait">
          <object-id content-type="arpha">7D796B65-3F6F-5A0E-93D7-89F2F0485B7B</object-id>
          <label>Figure 2.</label>
          <caption>
            <p><bold>A.</bold>The family history reconstruction. The arrow denotes the proband. Symbols (+) and (-) indicate <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EDKAC">LAMP2</abbrev></italic> mutation carriers and non-carriers, respectively. The absence of symbol denotes that no DNA was available for analysis. 2001, 2006, 2013 – years of birth; <bold>B.</bold> X-chromosome inactivation pattern in the proband (II-2; extracted from heart muscle) and affected son (III-2; extracted from buccal epithelium). Undigested (–Hin6I) and digested (+Hin6I) DNA samples are shown in the upper and lower plots respectively. The only 288-bp PCR fragment detected in the son (III-2) indicating the chromosome bearing c.190_191delАС. The absence of the corresponding peak area after Hin6I denoted that digestion of the active allele was sufficient; <bold>C.</bold> Mutation detection by DNA sequencing; <bold>D.</bold> Relationship between age of cardiomyopathy onset and inactivation level of a healthy allele in Danon patients. The single circles represent the data points, the line represents the quadratic trendline of the corresponding data set, and the numbers correspond to the cases in <bold>Table 1.</bold></p>
          </caption>
          <graphic xlink:href="foliamedica-64-5-e66292-g002.jpg" position="float" orientation="portrait" xlink:type="simple" id="oo_763178.jpg">
            <uri content-type="original_file">https://binary.pensoft.net/fig/763178</uri>
          </graphic>
        </fig>
        <table-wrap id="T1" position="float" orientation="portrait">
          <label>Table 1.</label>
          <caption>
            <p>Published data of XIC ratio in females with <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0E4KAC">LAMP2</abbrev></italic> mutations</p>
          </caption>
          <table id="TID0E1EAE" rules="all">
            <tbody>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">
                  <bold>No</bold>
                </td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">
                  <bold>Percentage of inactivated healthy allele</bold>
                </td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">
                  <bold>Age at cardiomyopathy diagnosis</bold>
                </td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">
                  <bold>Age at HT</bold>
                </td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">
                  <bold>Mutation</bold>
                </td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">
                  <bold>Method of XCI analysis</bold>
                </td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">
                  <bold>Reference</bold>
                </td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">1</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">75 in heart 86 in WBCs</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">15 (HCM)</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">29</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">c.940delG, p.Ala314Glnfs*32</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Flow cytometry</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Majer et al.<sup>[12]</sup></td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">2</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">66 in skeletal muscle 60 in WBCs</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">36 (HCM)</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">52</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">294G&gt;A, p.Try98*</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">HUMARA</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Fanin et al.<sup>[13]</sup></td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">3</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">66 in left ventricle</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">34 (<abbrev xlink:title="dilated cardiomyopathy" id="ABBRID0EPPAC">DCM</abbrev>)</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">37</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">c.190_191delАС, p.Val64Asnfs*11</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">HUMARA, RT-qPCR</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">This report</td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">4</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">56 in left ventricle 61 in septum 38 in WBCs</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">20 (HCM)</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">23</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">c.453delT,  p. Phe151fs</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">immune-histochemistry, HUMARA</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Bottillo et al.<sup>[14]</sup></td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">5</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">50 in left ventricle</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">51 (<abbrev xlink:title="dilated cardiomyopathy" id="ABBRID0E3BAE">DCM</abbrev>)</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">54</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">c.864+1G&gt;A, p.Val248_Val288del</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">RT-qPCR</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Sivitskaya et al.<sup>[15]</sup></td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">6</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">70 in WBCs</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Asymptomatic at the age of 38</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">-</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">c.808dupG,  p.Ala270Glyfs*3</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">HUMARA</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Chen et al.<sup>[16]</sup></td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">7</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">57 in WBCs</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">25 (<abbrev xlink:title="dilated cardiomyopathy" id="ABBRID0EFEAE">DCM</abbrev>)</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">28</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">c.445_449delGACCT, p.Asp149Phefs*2</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">HUMARA</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Gurka et al.<sup>[7]</sup></td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">8</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">46 in WBCs</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">23 (<abbrev xlink:title="dilated cardiomyopathy" id="ABBRID0EMFAE">DCM</abbrev>)</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">24</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">c.418delC,  p.Leu139Phefs*8</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">HUMARA</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Gurka et al.<sup>[7]</sup></td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">9</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">40 in WBCs</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">12 (HCD)</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">21</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Deletion of exons 4-8 g.17916_29069del11154</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">HUMARA</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Majer et al.<sup>[17]</sup></td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">10</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">30 in WBCs</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">11 (HCD)</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">-</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Deletion of exons 4-9C g.19925_45401del25477</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">HUMARA</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Majer et al.<sup>[17]</sup></td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">11</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">30 in WBCs 42 in buccal swabs 50 in urine 59 in hair follicles</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Asymptomatic at the age of 41</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">-</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Duplication  of exons 4-5: g.15815_22218dup6404</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">HUMARA</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Majer et al.<sup>[18]</sup></td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">12</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">20 in WBCs</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">16 (HCD)</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">27</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">c.718C&gt;T, p.Gln240*</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">HUMARA</td>
                <td rowspan="1" colspan="1" style="color: #1c1c1b">Gurka et al.<sup>[7]</sup></td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1">13</td>
                <td rowspan="1" colspan="1">18 in WBCs</td>
                <td rowspan="1" colspan="1">Asymptomatic at the age of 60</td>
                <td rowspan="1" colspan="1">-</td>
                <td rowspan="1" colspan="1">c.277G&gt;A, p.Gly93Arg</td>
                <td rowspan="1" colspan="1">HUMARA</td>
                <td rowspan="1" colspan="1">Xu et al.<sup>[19]</sup></td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn>
              <p><abbrev xlink:title="dilated cardiomyopathy" id="ABBRID0EYLAE">DCM</abbrev>: dilated cardiomyopathy; HCM: hypertrophic cardiomyopathy; HT: heart transplantation; HUMARA: human androgen receptor assay; WBCs: white blood cells.</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
      </sec>
      <sec sec-type="Males with c.190_191delAC show early cardiac phenotypes" id="SECID0E3LAE">
        <title>Males with c.190_191delAC show early cardiac phenotypes</title>
        <p><abbrev xlink:title="electrocardiogram" id="ABBRID0ECMAE">ECG</abbrev> abnormalities as a high <abbrev xlink:title="electrocardiogram" id="ABBRID0EGMAE">ECG</abbrev> voltage were observed in two sons with the mutation (III-2, III-3) at a very early age. One of them (III-3) didn’t show any significant neuromuscular involvement due to his young age. However, during the follow-up period, an elevated CK level was found (746 U/l; normal range, 24–124 U/l) and ambulatory HM study at 7 years of age demonstrated frequent premature ventricular contractions (<abbrev xlink:title="premature ventricular contractions" id="ABBRID0EKMAE">PVCs</abbrev>) up to 6500 <abbrev xlink:title="premature ventricular contractions" id="ABBRID0EOMAE">PVCs</abbrev>/24 h. He was symptomatic for palpitations and Echo confirmed the mild <abbrev xlink:title="left ventricular" id="ABBRID0ESMAE">LV</abbrev> hypertrophy (<abbrev xlink:title="left ventricular" id="ABBRID0EWMAE">LV</abbrev> septum thickness was 13 mm with absent <abbrev xlink:title="left ventricular" id="ABBRID0E1MAE">LV</abbrev> outflow tract obstruction).</p>
        <p>The older brother (III-2), who is mutation carrier as well, demonstrated an extreme high <abbrev xlink:title="electrocardiogram" id="ABBRID0EANAE">ECG</abbrev> voltage and pronounced left ventricular hypertrophy with deep negative T waves (<bold>Supplementary data, Fig. 1S</bold>). He had elevated levels of serum CK and liver ferments, mild proximal muscle weakness, learning disability and attention-deficit hyperactivity disorder. Abnormalities in laboratory parameters included serum аlanine aminotransferase (93 U/l; normal range, 9–36 U/l), serum aspartate aminotransferase (115 U/l; normal range, 15–40 U/l), serum CK (945 U/l; normal range, 24–124 U/l), serum isoenzyme CK (56 U/l; normal range, 0–24 U/l), and serum γ-glutamyl transpeptidase (72 U/l; normal range, 7–45 U/l). The chest X-ray revealed mild cardiomegaly. Echo showed <abbrev xlink:title="left ventricular" id="ABBRID0EGNAE">LV</abbrev> hypertrophy with speckles in the myocardium and good contractility (calculated indexed mass was 159 g/m<sup>2</sup>, maximum septal thickness 17 mm). Cardiac MRI revealed asymmetric <abbrev xlink:title="left ventricular" id="ABBRID0EMNAE">LV</abbrev> hypertrophy with papillary muscle and septum hypertrophy, fibrosis of the anterolateral papillary muscle and <abbrev xlink:title="left ventricular" id="ABBRID0EQNAE">LV</abbrev> anterolateral segments of the apex with local increase in T1- native mapping <bold>(Supplementary data, Fig. 1S)</bold>. Their clinical data at different ages are presented in <bold>Table 2.</bold></p>
        <table-wrap id="T2" position="float" orientation="portrait">
          <label>Table 2.</label>
          <caption>
            <p>Evolution of clinical phenotypes in affected family members with c.190_191delАС</p>
          </caption>
          <table id="TID0EAYAE" rules="all">
            <tbody>
              <tr>
                <td rowspan="1" colspan="1">
                  <bold>Parameter</bold>
                </td>
                <td rowspan="1" colspan="2">
                  <bold>Proband, female (II-2)</bold>
                </td>
                <td rowspan="1" colspan="2">
                  <bold>Сhild, male (III-2)</bold>
                </td>
                <td rowspan="1" colspan="2">
                  <bold>Child, male (III-3)</bold>
                </td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1">Age, years</td>
                <td rowspan="1" colspan="1">34</td>
                <td rowspan="1" colspan="1">36</td>
                <td rowspan="1" colspan="1">10</td>
                <td rowspan="1" colspan="1">14</td>
                <td rowspan="1" colspan="1">3</td>
                <td rowspan="1" colspan="1">7</td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1">Cardiomyopathy</td>
                <td rowspan="1" colspan="1">
                  <abbrev xlink:title="dilated cardiomyopathy" id="ABBRID0E1PAE">DCM</abbrev>
                </td>
                <td rowspan="1" colspan="1">
                  <abbrev xlink:title="dilated cardiomyopathy" id="ABBRID0ECQAE">DCM</abbrev>
                </td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1">HCM</td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1">HCM</td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1">Left ventricular end-diastolic volume / BSA, ml/m<sup>2</sup></td>
                <td rowspan="1" colspan="1">158</td>
                <td rowspan="1" colspan="1">203</td>
                <td rowspan="1" colspan="1">62</td>
                <td rowspan="1" colspan="1">78</td>
                <td rowspan="1" colspan="1">37</td>
                <td rowspan="1" colspan="1">47</td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1">Intraventricular septal diameter diastole, mm</td>
                <td rowspan="1" colspan="1">10</td>
                <td rowspan="1" colspan="1">9</td>
                <td rowspan="1" colspan="1">12</td>
                <td rowspan="1" colspan="1">17</td>
                <td rowspan="1" colspan="1">6</td>
                <td rowspan="1" colspan="1">13</td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1">Left ventricular ejection fraction, %</td>
                <td rowspan="1" colspan="1">30</td>
                <td rowspan="1" colspan="1">15</td>
                <td rowspan="1" colspan="1">70</td>
                <td rowspan="1" colspan="1">74</td>
                <td rowspan="1" colspan="1">71</td>
                <td rowspan="1" colspan="1">73</td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1">Calculated myocardial mass index, g/m<sup>2</sup></td>
                <td rowspan="1" colspan="1">111</td>
                <td rowspan="1" colspan="1">127</td>
                <td rowspan="1" colspan="1">93</td>
                <td rowspan="1" colspan="1">159</td>
                <td rowspan="1" colspan="1">56</td>
                <td rowspan="1" colspan="1">92</td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1">Creatine kinase level, muscle soform</td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1">↑</td>
                <td rowspan="1" colspan="1">↑</td>
                <td rowspan="1" colspan="1">↑</td>
                <td rowspan="1" colspan="1">↑</td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1">Arrhythmia</td>
                <td rowspan="1" colspan="1">WPW, SVT</td>
                <td rowspan="1" colspan="1">AF, <abbrev xlink:title="premature ventricular contractions" id="ABBRID0EPUAE">PVCs</abbrev>, nsVT</td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1"><abbrev xlink:title="premature ventricular contractions" id="ABBRID0E1UAE">PVCs</abbrev> (546/24h)</td>
                <td rowspan="1" colspan="1"><abbrev xlink:title="premature ventricular contractions" id="ABBRID0ECVAE">PVCs</abbrev> (354/24h)</td>
                <td rowspan="1" colspan="1"><abbrev xlink:title="premature ventricular contractions" id="ABBRID0EKVAE">PVCs</abbrev> (6457/24h)</td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1">Heart transplantation, age</td>
                <td rowspan="1" colspan="1">-</td>
                <td rowspan="1" colspan="1">36</td>
                <td rowspan="1" colspan="1">-</td>
                <td rowspan="1" colspan="1">-</td>
                <td rowspan="1" colspan="1">-</td>
                <td rowspan="1" colspan="1">-</td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1">Skeletal myopathy</td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1">+ (mild)</td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1">+ (mild)</td>
              </tr>
              <tr>
                <td rowspan="1" colspan="1">Developmental delay</td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1">+ (mild)</td>
                <td rowspan="1" colspan="1">N</td>
                <td rowspan="1" colspan="1">N</td>
              </tr>
            </tbody>
          </table>
          <table-wrap-foot>
            <fn>
              <p>↑: elevated; +: present; N: negative or normal; BSA: body surface area; <abbrev xlink:title="dilated cardiomyopathy" id="ABBRID0EUXAE">DCM</abbrev>: dilated cardiomyopathy; HCM: hypertrophic cardiomyopathy; AF: atrial flutter; nsVT: non-sustained ventricular tachycardia; SVT: supraventricular tachycardia; <abbrev xlink:title="premature ventricular contractions" id="ABBRID0EYXAE">PVCs</abbrev>: premature ventricular contractions; WPW: Wolff-Parkinson-White syndrome</p>
            </fn>
          </table-wrap-foot>
        </table-wrap>
      </sec>
      <sec sec-type="Decrease of healthy LAMP2 allele expression in the heart leads to cardiac phenotype in a female" id="SECID0E3XAE">
        <title>Decrease of healthy <italic>LAMP2</italic> allele expression in the heart leads to cardiac phenotype in a female</title>
        <p>To assess the portion of cardiomyocytes expressing healthy <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EJYAE">LAMP2</abbrev></italic> allele, we measured X-chromosome inactivation in heart muscle of proband II-2 <bold>(Fig. 2)</bold>. The plots indicate a quantitative measure of the fluorescent PCR products. The <abbrev xlink:title="androgen receptor" id="ABBRID0EPYAE">AR</abbrev> gene amplification of undigested genomic DNA identified the woman as heterozygote of CAG-repeat: 282 and 288 bp fragments in equal proportion. After Hin6I-digestion and following <abbrev xlink:title="androgen receptor" id="ABBRID0ETYAE">AR</abbrev>-amplification the peak areas were decreased according to the methylated status of the gene. As a result, we observed random X-inactivation at 66:34 ratio. It means that the proportion of cells expressing healthy <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EYYAE">LAMP2</abbrev></italic> allele of the X-chromosome (282 bp) was reduced to 34%.</p>
        <p>Except for the XCI process, other factors could affect the in vivo allelic expression of X-linked gene.<sup>[<xref ref-type="bibr" rid="B20">20</xref>]</sup> To evaluate <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EGZAE">LAMP2</abbrev></italic> mRNA expression, we performed quantitative real-time RT-PCR (RT-qPCR) and obtained similar results. Comparing to controls, the expression level of healthy <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0ELZAE">LAMP2</abbrev></italic> allele was ~70% lower in the proband II-2 than in control subjects (0.31±0.04, <italic>p</italic>&lt;0.05). It means, only one-third of <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0ESZAE">LAMP2</abbrev></italic> transcripts can be translated into the native protein. We did not observe the skewed XCI in proband II-2, but the obvious decrease of healthy allele expression in the heart led to severe cardiac phenotype.</p>
        <p>We found 13 detailed reports of <abbrev xlink:title="Danon disease" id="ABBRID0EYZAE">DD</abbrev> cases published until January 2021 where XCI status was measured <bold>(Table 2)</bold>. Of note, the XCI ratio was variable in different tissues: the X-inactivation in urine, hair follicles, buccal swabs and leucocytes did not correspond to that in affected tissues (heart, skeletal muscles). To assess the relation between XCI pattern and age of cardiomyopathy onset, we considered only cases where XCI was measured in skeletal or cardiac muscles (n=5). We had to exclude from analysis asymptomatic persons as well because it is possible that they will develop symptoms in the future. Despite these limitations, we have attempted to evaluate the relationship between the XCI and age of cardiomyopathy onset and found a visible inverse linear correlation <bold>(Fig. 2D)</bold>. Women with strongly inactivated healthy X-chromosome had earlier <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EB1AE">LAMP2</abbrev></italic>-cardiomyopathy manifestation compared with weak inactivation. Nevertheless, the Pearson correlation coefficient was statistically insignificant -0.63, CI 95% [-0.97:0.56].</p>
      </sec>
    </sec>
    <sec sec-type="Discussion" id="SECID0EF1AE">
      <title>Discussion</title>
      <p>We identified a new <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EM1AE">LAMP2</abbrev></italic> variant in a family with a history of heart failure and described disease variability and outcomes in three affected members. The variant c.190_191delАС leads to severe morbidity for male and female carriers and can be classified as pathogenic according to the criteria reported by Richards et al.<sup>[<xref ref-type="bibr" rid="B21">21</xref>]</sup> In the presented case the affected woman (II-2) has only cardiac involvement manifested as phenocopy of dilated cardiomyopathy in her thirties. The search for a causal variant by NGS led to the identification of new <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EY1AE">LAMP2</abbrev></italic> mutation and correction of the initial diagnosis for Danon disease. This pathology often stays unrecognized in women due to the absence of the specific signs. Because females have two X chromosomes, they have a milder and more variable phenotype than males. The onset of <abbrev xlink:title="Danon disease" id="ABBRID0E31AE">DD</abbrev> is in late adulthood and shows a slower progression. In the observed family, the presenting phenotype in the female proband was dilated cardiomyopathy in her thirties, whereas her two sons had hypertrophic cardiomyopathy since their childhood. As is expected, the clinical picture for the sons does not promise an optimistic scenario.</p>
      <p>Like many other X-linked diseases, the severity of <abbrev xlink:title="Danon disease" id="ABBRID0EC2AE">DD</abbrev> in females depends on XCI status in affected tissues. However, the data on the impact of XCI on Danon phenotype published until today is limited <bold>(Table 2)</bold>. We consider it is important to collect data about the <abbrev xlink:title="Danon disease" id="ABBRID0EI2AE">DD</abbrev> onset and XCI status in women. This must have prognostic significance, especially in families where several female members carry <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EN2AE">LAMP2</abbrev></italic> mutation. In the case published by Arad et al.<sup>[<xref ref-type="bibr" rid="B22">22</xref>]</sup>, seven women with the pathogenic <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EZ2AE">LAMP2</abbrev></italic> variant have been reported in the same family. Six of them were asymptomatic at the age of 14–49 years at the moment of publication, while one woman died from congestive heart failure at 44 years. This variability can be explained by the different degrees of the mutant X chromosome inactivation: more in asymptomatic members and less in a deceased woman. Moreover, <abbrev xlink:title="Danon disease" id="ABBRID0E42AE">DD</abbrev> cannot be excluded in young asymptomatic females in their future life. Disease development prognosis is required for such families.</p>
      <p>We have attempted to evaluate the relationship between the XCI in muscle and cardiomyopathy onset as the main life-threatening symptom. The limited data did not allow us to demonstrate the reliable linear correlation. But these results reveal the need for further investigation of tissue-specific XCI and clinical outcomes in female <abbrev xlink:title="Danon disease" id="ABBRID0ED3AE">DD</abbrev> patients.</p>
      <p>Unfortunately, the XCI status in blood cells as the most available tissue is not appropriate for <abbrev xlink:title="Danon disease" id="ABBRID0EJ3AE">DD</abbrev> prognosis. The XCI pattern is specific to tissue or organ compartments where clinical features are observed – heart, skeletal muscle and brain. Since the heart tissue is often unavailable for investigation, the severity of cardiac phenotypes in women with <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EO3AE">LAMP2</abbrev></italic> mutations remain difficult to predict.</p>
      <p>In conclusion, the 2bp-deletion c.190_191delАС in <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EV3AE">LAMP2</abbrev></italic> was identified in the family with sudden cardiac death history and three members with cardiomyopathy. Based on the strong association of truncating <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0E13AE">LAMP2</abbrev></italic> mutations with Danon disease and clinical phenotypes observed in carriers, c.190_191delАС can be classified as pathogenic. In males it led to completely lost of function <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0E63AE">LAMP2</abbrev></italic> due to a single copy of this gene. In a woman, cardiomyopathy developed because of both the <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EE4AE">LAMP2</abbrev></italic> mutation and a decrease in the expression of a healthy allele in the heart.</p>
    </sec>
    <sec sec-type="Appendix A. Supplementary data" id="SECID0EI4AE">
      <title>Appendix A. Supplementary data</title>
      <p>
        <bold>Author contributions</bold>
      </p>
      <p>L.S. and T.V. - study design, manuscript preparation; T.V. - clinical investigations, L.S. and A.L. - NGS data and mutation analysis; N.D., O.D., and N.Z. - data interpretation and manuscript editing.</p>
      <table-wrap id="T3" position="float" orientation="portrait">
        <label>Table 1S.</label>
        <caption>
          <p>Specification of <abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0E14AE">LAMP2</abbrev> primer and probe sequences</p>
        </caption>
        <table id="TID0EIHAG" rules="all">
          <tbody>
            <tr>
              <td rowspan="1" colspan="1">
                <bold>Primer name</bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>Binding site position</bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>Sequence (5’-3’)</bold>
              </td>
              <td rowspan="1" colspan="1">
                <bold>product length, bp</bold>
              </td>
            </tr>
            <tr>
              <td rowspan="1" colspan="4"><bold>Primers used for Sanger sequencing of exon 3</bold> (refer to NM_007995.1)</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1"><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EK6AE">LAMP2</abbrev> (3F)</td>
              <td rowspan="1" colspan="1">19116-19135</td>
              <td rowspan="1" colspan="1">GGGGTCAGTGGGAGGGTTAT</td>
              <td rowspan="2" colspan="1">490</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1"><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0E36AE">LAMP2</abbrev> (3R)</td>
              <td rowspan="1" colspan="1">18646-18665</td>
              <td rowspan="1" colspan="1">CACAGCAAACCAGGCAAAGG</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="4"><bold>TaqMan assay for exon 3 of <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0EPAAG">LAMP2</abbrev></italic></bold> (refer to NM_001122606.1)</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">F(LAMP2_ex3)</td>
              <td rowspan="1" colspan="1">284-303</td>
              <td rowspan="1" colspan="1">ATTCAGAAAATGCCACTTGC</td>
              <td rowspan="3" colspan="1">146</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">R(LAMP2_ex3)</td>
              <td rowspan="1" colspan="1">411-430</td>
              <td rowspan="1" colspan="1">TCTGATCATCCCCACAAATG</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1">Probe (LAMP2_ex3)</td>
              <td rowspan="1" colspan="1">359-385</td>
              <td rowspan="1" colspan="1">FAM-CTTATAAAACTGTAACCATTTCAGACC-BHQ1</td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <fig id="F3" position="float" orientation="portrait">
        <object-id content-type="arpha">51A459BE-9EA0-532C-87CE-5CD278AE2B8B</object-id>
        <label>Figure 1S.</label>
        <caption>
          <p>Cardiac abnormalities in carrier (III-2) <italic><abbrev xlink:title="lysosome-associated membrane protein 2 gene" id="ABBRID0E4BAG">LAMP2</abbrev></italic> mutation: <bold>(A)</bold> Patient’s <abbrev xlink:title="electrocardiogram" id="ABBRID0EDCAG">ECG</abbrev> is registered at age 14, showing normal sinus rhythm, <abbrev xlink:title="left ventricular" id="ABBRID0EHCAG">LV</abbrev> hypertrophy and prominent T wave inversion in leads I, V3-V6; <bold>(B)</bold> Cardiac MRI plan the 4-chamber cine on the long axis image shows <abbrev xlink:title="left ventricular" id="ABBRID0ENCAG">LV</abbrev> hypertrophy (maximum septal thickness 17 mm); <bold>(C)</bold> Cardiac short-axis orientation with two-chamber view image of <abbrev xlink:title="left ventricular" id="ABBRID0ETCAG">LV</abbrev> hypertrophy; <bold>(D)</bold> Late-gadolinium enhancement imaging on the long axis indicates presence of midwall myocardial contrast delay pattern with fibrosis of the anterolateral papillary muscle and anterolateral segments of the <abbrev xlink:title="left ventricular" id="ABBRID0EZCAG">LV</abbrev> apex (arrowheads); <bold>(E)</bold> Tissue <abbrev xlink:title="left ventricular" id="ABBRID0E6CAG">LV</abbrev> characteristic: bull’s eye map image demonstrates late gadolinium enhancement (short axis; grade 0-100%).</p>
        </caption>
        <graphic xlink:href="foliamedica-64-5-e66292-g003.jpg" position="float" orientation="portrait" xlink:type="simple" id="oo_763179.jpg">
          <uri content-type="original_file">https://binary.pensoft.net/fig/763179</uri>
        </graphic>
      </fig>
    </sec>
    <sec sec-type="Acknowledgements" id="SECID0EIDAG">
      <title>Acknowledgements</title>
      <p>The authors have no support to report.</p>
    </sec>
    <sec sec-type="Funding" id="SECID0ENDAG">
      <title>Funding</title>
      <p>The authors have no funding to report.</p>
    </sec>
    <sec sec-type="Competing interests" id="SECID0ESDAG">
      <title>Competing interests</title>
      <p>The authors have declared that no competing interests exist.</p>
    </sec>
    <sec sec-type="References" id="SECID0EXDAG">
      <title>References</title>
    </sec>
  </body>
  <back>
    <ref-list>
      <ref id="B1">
        <mixed-citation xlink:type="simple">1. Danon MJ, Oh SJ, DiMauro S, et al. Lysosomal glycogen storage disease with normal acid maltase. Neurology 1981; 31(1):51.</mixed-citation>
      </ref>
      <ref id="B2">
        <mixed-citation xlink:type="simple">2. Brambatti M, Caspi O, Maolo A, et al. Danon disease: gender differences in presentation and outcomes. Int J Cardiol 2019; 286:92–8.</mixed-citation>
      </ref>
      <ref id="B3">
        <mixed-citation xlink:type="simple">3. D’souza RS, Mestroni L, Taylor MRG. Danon disease for the cardiologist: case report and review of the literature. J Community Hosp Intern Med Perspect 2017; 7(2):107–14.</mixed-citation>
      </ref>
      <ref id="B4">
        <mixed-citation xlink:type="simple">4. Modrego P, López-Pisón F, Alfaro J. Enfermedad de Danon y nueva mutación del gen LAMP-2 en una familia española. [Danon disease and a new mutation of the LAMP-2 gene in a Spanish family] Neurología 2017; 32(5):331–2. doi: <ext-link xlink:type="simple" ext-link-type="doi" xlink:href="10.1016/j.nrl.2015.07.003">10.1016/j.nrl.2015.07.003</ext-link> [Spanish]</mixed-citation>
      </ref>
      <ref id="B5">
        <mixed-citation xlink:type="simple">5. Charron P. Danon’s disease as a cause of hypertrophic cardiomyopathy: a systematic survey. Heart 2004; 90(8):842–6.</mixed-citation>
      </ref>
      <ref id="B6">
        <mixed-citation xlink:type="simple">6. Samad F, Jain R, Jan MF, et al. Malignant cardiac phenotypic expression of Danon disease (LAMP2 cardiomyopathy). Int J Cardiol 2017; 245:201–6.</mixed-citation>
      </ref>
      <ref id="B7">
        <mixed-citation xlink:type="simple">7. Gurka J, Piherova L, Majer F, et al. Danon disease is an underdiagnosed cause of advanced heart failure in young female patients: a LAMP2 flow cytometric study. ESC Heart Failure 2020; 7(5):2534–43.</mixed-citation>
      </ref>
      <ref id="B8">
        <mixed-citation xlink:type="simple">8. Karasawa M, Tsukamoto N, Yamane A, et al. Analysis of the distribution of CAG repeats and X-chromosome inactivation status of HUMARA gene in healthy female subjects using improved fluorescence-based assay. Int J Hematol 2001; 74(3):281–6.</mixed-citation>
      </ref>
      <ref id="B9">
        <mixed-citation xlink:type="simple">9. Miracco C, De Nisi MC, Arcuri F, et al. Macrophage migration inhibitory factor protein and mRNA expression in cutaneous melanocytic tumours. Int J Oncol 2006; 28(2):345–52.</mixed-citation>
      </ref>
      <ref id="B10">
        <mixed-citation xlink:type="simple">10. Caracausi M, Piovesan A, Antonaros F, et al. Systematic identification of human housekeeping genes possibly useful as references in gene expression studies. Mol Med Rep 2017; 16(3):2397–410.</mixed-citation>
      </ref>
      <ref id="B11">
        <mixed-citation xlink:type="simple">11. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001; 25(4):402–8.</mixed-citation>
      </ref>
      <ref id="B12">
        <mixed-citation xlink:type="simple">12. Majer F, Vlaskova H, Krol L, et al. Danon disease: A focus on processing of the novel LAMP2 mutation and comments on the beneficial use of peripheral white blood cells in the diagnosis of LAMP2 deficiency. Gene 2012; 498(2):183–95.</mixed-citation>
      </ref>
      <ref id="B13">
        <mixed-citation xlink:type="simple">13. Fanin M, Nascimbeni AC, Fulizio L, et al. Generalized lysosome-associated membrane protein-2 defect explains multisystem clinical involvement and allows leukocyte diagnostic screening in Danon disease. Am J Path 2006;168(4):1309–20.</mixed-citation>
      </ref>
      <ref id="B14">
        <mixed-citation xlink:type="simple">14. Bottillo I, Giordano C, Cerbelli B, et al. A novel LAMP2 mutation associated with severe cardiac hypertrophy and microvascular remodeling in a female with Danon disease: a case report and literature review. Cardiovasc Pathol 2016; 25(5):423–31.</mixed-citation>
      </ref>
      <ref id="B15">
        <mixed-citation xlink:type="simple">15. Sivitskaya L, Vaikhanskaya T, Danilenko N, et al. Splicing mutation in LAMP2 gene leading to exon skipping and cardiomyopathy development. Gene Reports 2020; 18:100564.</mixed-citation>
      </ref>
      <ref id="B16">
        <mixed-citation xlink:type="simple">16. Chen X, Zhao Y, Ke H, et al. Detection of somatic and germline mosaicism for the LAMP2 gene mutation c.808dupG in a Chinese family with Danon disease. Gene 2012; 507(2):174–6.</mixed-citation>
      </ref>
      <ref id="B17">
        <mixed-citation xlink:type="simple">17. Majer F, Piherova L, Reboun M, et al. LAMP2 exon-copy number variations in Danon disease heterozygote female probands: Infrequent or underdetected? Am J Med Genet 2018; 176(11):2430–4.</mixed-citation>
      </ref>
      <ref id="B18">
        <mixed-citation xlink:type="simple">18. Majer F, Pelak O, Kalina T, et al. Mosaic tissue distribution of the tandem duplication of LAMP2 exons 4 and 5 demonstrates the limits of Danon disease cellular and molecular diagnostics. J Inherit Metab Dis 2014; 37(1):117–24.</mixed-citation>
      </ref>
      <ref id="B19">
        <mixed-citation xlink:type="simple">19. Xu J, Wang L, Liu X, et al. A novel LAMP2 p. G93R mutation associated with mild Danon disease presenting with familial hypertrophic cardiomyopathy. Mol Genet Genomic Med 2019; 7(10):e00941.</mixed-citation>
      </ref>
      <ref id="B20">
        <mixed-citation xlink:type="simple">20. Talebizadeh Z, Simon SD, Butler MG. X chromosome gene expression in human tissues: Male and female comparisons. Genomics 2006; 88(6):675–81.</mixed-citation>
      </ref>
      <ref id="B21">
        <mixed-citation xlink:type="simple">21. Richards S, Aziz N, Bale S, et al. Standards and guidelines for the interpretation of sequence variants: a joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet Med 2015; 17(5):405–23.</mixed-citation>
      </ref>
      <ref id="B22">
        <mixed-citation xlink:type="simple">22. Arad M, Maron BJ, Gorham JM, et al. Glycogen storage diseases presenting as hypertrophic cardiomyopathy. N Engl J Med 2005; 352(4):362–72.</mixed-citation>
      </ref>
    </ref-list>
  </back>
</article>
