Original Article |
|
Corresponding author: Mahmood Abedinzade ( mahmood.abedinzade@gmail.com ) © 2022 Korosh Khanaki, Adel Fekri, Mahmood Abedinzade, Ekram Mohammadi, Fakhroddin Aghajanpour.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Khanaki K, Fekri A, Abedinzade M, Mohammadi E, Aghajanpour F (2022) Potential anti-inflammatory effect of Lamium album extract through caspase-3 and cyclooxygenase-2 genes expression in a rat model of middle cerebral artery occlusion. Folia Medica 64(2): 275-282. https://doi.org/10.3897/folmed.64.e60562
|
Introduction: Stroke is one of the most common causes of death worldwide. Inflammation and apoptosis play an important role in the cascade of ischemic stroke.
Aim: The aim of the present study was to evaluate the pretreatment effects of Lamium album (L. album) extract on caspase-3 and cyclooxygenase-2 (COX-2) expression, infarct volume, and neurological deficit score in a rat model of middle cerebral artery occlusion (MCAO).
Materials and methods: Wistar male rats were randomly divided into three groups: 1) MCAO group (1 h after MCAO, reperfusion was allowed for 24 h by retracting the thread); 2) L. album + MCAO group [receiving L. album extract (100 mg/kg via intraperitoneal) for a week before MCAO]; 3) sham group. The expression level of caspase-3 and COX-2 in the core, penumbra, and subcortex regions was measured by real time-PCR technique. Infarct volume and neurological deficit score were also assessed.
Results: The mRNA expression of caspase-3 in the core, penumbra, and subcortex regions in L. album group was significantly reduced compared to MCAO group (p<0.05). Expression level of COX-2 in the subcortex of the rats exposed to L. album was statistically decreased relative to MCAO group (p<0.05). Infarct volume in the core, penumbra, and subcortex was significantly reduced in the L. album group compared with MCAO group (p<0.001, p<0.001, p<0.05, respectively). Neurological deficit score was remarkably decreased in the L. album group in comparison with the MCAO group (p<0.05).
Conclusions: It appears that pretreatment with L. album extract may attenuate brain tissue damage after ischemic stroke. The potential protective effects of this plant extract against this condition might be in part attributed to its anti-inflammatory and anti-apoptotic activities.
caspase-3, cyclooxygenase-2, Lamium album, stroke
Stroke is the second leading cause of death worldwide, after heart disease. Ischemic stroke including acute and chronic phases accounts for 80% of stroke cases.[
Following induction of cerebral ischemia, two regions of the core and penumbra develop in the brain. In the core, blood flow drops to less than 10%–25%. The penumbra lies between the normally perfused part and the area where the infarction is developing. Some previous studies reported that expression of caspase-3 and COX-2 genes was increased in both regions leading to cell death.[
Thrombolytic drugs were prescribed to treat ischemic stroke, but their use was limited because of complications such as intracranial hemorrhage, myocardial rupture, and immune system disorders. Furthermore, the lack of efficient and appropriate pharmacological treatment for ischemic stroke might explain the growing interest in traditional herbal medicines.[
White dead nettle or Lamium album (L. album), is a plant of the Lamiaceae herb family used in traditional Chinese medicine, North Africa, and Europe in the treatment of several disorders such as trauma, paralysis, hypertension, cancer, and arthritis.[
With regard to the role of inflammatory and apoptotic signalling pathways in the extent and severity of stroke injury, the aim of the present study was to evaluate the potential protective effects of L. album extract on caspase-3 and COX-2 expression, infarct volume (IV), and neurological deficit score (NDS) in a rat model of middle cerebral artery occlusion (MCAO).
Twenty-four male Wistar rats, ranging in weight from 250 to 300 g, were obtained from the Animal Care Center of Guilan University of Medical Sciences (Rasht, Iran). The animals were adapted to the standard laboratory conditions (12 h light: 12 h dark cycles at 22°-24°C) one week before performing the experiment. The rats had free access to adequate water and food during the experiment.
All experiments were carried out based on the international principles for laboratory animal use and care as determined in the US guidelines (NIH publication #85-23, revised in 1985). The Ethics Committee of Guilan University of Medical Sciences (Iran, Rasht) approved all procedures in this study (IR.GUMS.REC.1395.291).
The animals were randomly divided into three groups: 1) MCAO group: 1 h after MCAO, reperfusion was allowed for 24 h by retracting the thread (n=9); 2) L. album + MCAO group with the rats receiving L. album extract [100 mg/kg via intraperitoneal (IP)] for a week before MCAO, on the 7th day, 1 h after MCAO, reperfusion was allowed for 24 h by retracting the thread (n=9); 3) the sham group: like the MCAO group, they underwent surgery, but their middle cerebral artery did not occlude (n=6). The animals’ motor function was randomly assessed 24 h after ischemic induction, then the animals were euthanized and their brains were removed to examine the expression level of caspase-3 and COX-2 and IV.
The L. album for the study was collected from the Rasht region (Guilan Province, Iran). It was identified by Fatemeh Yousefbeyk, Department of Pharmacognosy, Guilan University of Medical Sciences (Rasht, Iran) (voucher specimen No. 202HGUM). The hydroalcoholic extract was prepared by macerating the powder of stems and leaves in 50% ethanol (10 ml/g powder) for 72 h at 40°C. The extract was then filtered through a 250-μm mesh, centrifuged for 10 min at 2000 rpm, and its supernatant was dried in a water bath (40°C). Based on our previous study, total phenolic and flavonoid content in L. album extract was 0.61 (mg GAL/g) and 2.10 (mg QE/g), respectively.[
Induction of MCAO was performed according to the method of Longa et al.[
NDS was randomly evaluated 24 h after MCAO according to Longa et al. study.[
The animals were killed and their brains were removed rapidly and accurately 24 h after reperfusion. Eight coronal sections (2 mm thick, Brain Matrix, Tehran, Iran) were prepared from their brains. Sections were stained for 15 min at 37°C in 2% 2,3,5-triphenyltetrazolium chloride (TTC) solution (Merck, Germany). The slices were then digitally photographed by a camera (Canon, DSC-W310) connected to the computer. Unstained areas were defined as infarcts and were measured using image analysis software. The lesion volume was calculated by measuring the unstained and the stained areas in each hemisphere slice, and then summation all of the eight slices according to the method of Swanson et al.[
The brain tissue pieces were immediately transferred to liquid nitrogen until assessment of COX-2 and caspase-3 gene expression. In brief, total RNA was extracted based on the manufacturer instructions (YEKTA TAJHIZ AZMA, Iran). The purity of the extracted RNA was assessed by measuring the absorbance at 260/280 nm using the Nanodrop spectrophotometer (Thermo Fisher Scientific Inc., USA). Then the extracted RNA was treated with DNase to eliminate possible contamination. HyperScript™ First-strand Synthesis Kit (GeneAll, South Korea) was used to synthesize cDNA at 55°C for 60 min in accordance with the protocols explained by the manufacturer’s instructions. To quantify the mRNA expression level of caspase-3 and COX-2, real-time PCR was performed by using the ABI instrument (StepOne™, USA). GAPDH was used as housekeeping gene for normalization of COX-2 and caspase-3 expression levels. The PCR primers (forward and reverse) of the studied genes were designed with Primer3web (version 4.0.0) (Table
Data are presented as mean ± SD as appropriate. Inter-group comparisons were performed using the one-way analysis of variance (ANOVA) followed by post-hoc Tukey’s test. P<0.05 was considered statistically significant for the tests. SPSS 16 software was used for data analysis. Graphs were designed by GraphPad Prism 5.04 (Graphpad Software, Inc).
NDS test was used to evaluate the motor function of rats in different experimental groups. NDS in the rats pretreated with L. album extract was significantly reduced compared to MCAO group (p<0.05). Therefore, pretreatment with this extract improved motor activity (Table
TTC stained coronal sections of the brains showed that IV in the core, penumbra, and subcortex regions of the rats pretreated with L. album extract was significantly lower than that in the MCAO group (p<0.001, p<0.001, p<0.05, respectively) (Fig.
The expression level of caspase-3 was increased in the core, penumbra, and subcortex in the MCAO group compared with that in the sham group (Fig.
| Genes name | Sequence (5´ → 3´) | Annealing | Product size |
| Cox-2-F | ATGATCTACCCTCCCCACGT | 54°C×30 s | 119 |
| Cox-2-R | ACTCTGTTGTGCTCCCGAAG | ||
| Caspase-3-F | GCTGGACCCGTATTGAGA | 55°C×30 s | 142 |
| Caspase-3-R | CCATGACCCGTCCCTTGAAT | ||
| GAPDH-F | CCACAGTCCATGCCATCACT | 60°C×25 s | 101 |
| GAPDH-R | TGCAGGGATGATGTTCTGGG |
Distribution of neurologic deficit score (NDS) in experimental groups (n=4)
| Experimental groups | NDS in each group | Total (N) | P value | |||||
| 0 | 1 | 2 | 3 | 4 | 5 | |||
| MCAO | 0 | 0 | 3 | 4 | 2 | 0 | 9 | p<0.05* |
| L. album pretreatment | 2 | 2 | 2 | 2 | 1 | 0 | 9 | |
(A) TTC stained sections for each group; (B) Core, penumbra and subcortex; (C) The effect of pretreatment with L. album (100 mg/kg) on infarct volume (IV) in the core, penumbra, and subcortex regions. L. album group considerably exhibited less IV relative to the MCAO group. Data are presented as mean ±SD (n=4). * p<0.001, # p<0.05.
Effect of L. album extract on caspase-3 gene expression in core, penumbra, and subcortex. Values are expressed as mean ± SD (n=5). * p<0.05 compared with sham group; # p<0.05 compared with L. album + MCAO group.
In this experimental study, we investigated the potential protective effects of L. album extract on caspase-3 and COX-2 expressions (as apoptotic and inflammatory markers) in the MCAO model. The main findings were: (1) L. album protected the brain from ischemia; (2) L. album decreased caspase-3 and COX-2 expression level in core, penumbra, and subcortex regions; (3) L. album decreased the extent of lesion and improved motor activity.
L. album
, a herbal plant with anti-inflammatory and neuroprotective properties, is used in traditional Chinese medicine to treat various diseases. Its antioxidant compounds include iridoid, kaempferol, and verbascoside, which have been studied for beneficial effects on stroke and neurodegenerative diseases.[
It was previously documented that caspase-3 could have a fundamental role in the execution phase of programmed cell death. The expression level of this apoptotic marker in cerebral ischemia was increased in penumbra and core regions. Also, the important role of caspase-3 in the progression of lesion extent and behavioural impairment associated with injury was reported. It was determined that neurons were main population undergoing apoptosis 1 h after ischemia.[
In this experiment, the effects of L. album on the IV and NDS were evaluated. This extract significantly reduced the extent of injury and motor impairment, which may be due to the inhibition of caspase-3 and COX-2 expression in different regions of the brain following cerebral ischemia. It was shown that the ischemic stroke was associated with the production of inflammatory factors such as IL-1β, COX-2, NO, IL-6, and TNF-α.[
In the present study, practically all main regions of the rat brain were examined separately. Moreover, the total phenolic and flavonoids contents of L. album were evaluated. However, some limitations should be considered: 1) the enzymatic activity of COX-2 and caspase-3 was not evaluated. 2) One dose of this plant extract was utilized.
The potential protective effects of this plant extract against this condition might be in part attributed to its anti-inflammatory activity. Further investigation of the neuroprotective effects of L. album on chronic inflammatory processes, microglial cell activity, and adhesion molecules in neurodegenerative diseases is warranted.
It appears that pretreatment with L. album extract may attenuate brain tissue damage after ischemic stroke. The potential protective effects of this plant extract against this condition might be in part attributed to its anti-inflammatory and anti-apoptotic activities, although further studies in this field are needed.
This research was financially supported by the Research Deputy of Guilan University of Medical Sciences, Rasht, Iran.
Conflict of interest
The authors declare that they have no conflict of interest in this study.