Original Article |
|
Corresponding author: Maryam Koopaie ( mariakoopaie@gmail.com ) Corresponding author: Neda Hakimiha ( ned.hakimiha@gmail.com ) © 2022 Shadi Kahalian, Maryam Koopaie, Neda Hakimiha, Sajad Kolahdooz.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Kahalian S, Koopaie M, Hakimiha N, Kolahdooz S (2022) Assessment of the methylene blue mediated photodynamic therapy on BCL2 and BAX genes expression at mRNA level and apoptosis of head and neck squamous cell carcinoma cell line. Folia Medica 64(2): 221-228. https://doi.org/10.3897/folmed.64.e60825
|
Aim: This study aimed to assess the effect of photodynamic therapy (PDT) on apoptosis of head and neck squamous cell carcinoma (HNSCC) cells by flow cytometry and evaluating BAX and BCL2 genes expression.
Materials and methods: In this in vitro study, human HNSCC cell line (HN5; NCBI. C196) was used and after cell culture, they were divided into four groups: controls (group C), cells irradiated by a diode laser with a wavelength of 660 nm, 150 mW power, and 45 J/cm2 energy density (group L), cells treated by methylene blue (group MB), and cells treated using PDT (group MB plus L). The RNA was then extracted and subjected to quantitative reverse transcription polymerase chain reaction (qRT-PCR) to assess BCL2 and BAX genes expression. Flow cytometry analysis was performed to assess apoptosis. Data were analysed using ANOVA.
Results: PDT caused significant down-regulation of BCL2 (p<0.001) and significant overexpression of BAX (p<0.05) and PDT induced apoptosis HNSCC cell line. Changes in expression of these genes were not significant in other groups (p>0.05).
Conclusions: Considering the down-regulation of BCL2 and overexpression of BAX after PDT using a 660-nm diode laser and MB with 3.2 µg/mL concentration and flow cytometry results, it is suggested that this modality can be introduced for induction of apoptosis in the HNSCC cell line.
apoptosis, BAX, BCL2, head and neck squamous cell carcinoma (HNSCC), photodynamic therapy, qRT-PCR
Head and neck squamous cell carcinoma (HNSCC) is the most common malignancy of the head and neck region with relatively low survival rate and response and high resistance to treatment.[
Evidence shows that laser therapy has several advantages for resection of oral mucosal lesions such as excellent hemostasis, precise incision, and minimal damage to the adjacent tissues.[
Apoptosis refers to programmed cell death, and defects in apoptosis can lead to carcinogenesis.[
Considering all the above, this study aimed to assess the effect of PDT with diode laser on apoptosis and expression of pro-apoptotic BAX and anti-apoptotic BCL2 gene in HNSCC cell line.
In this in vitro experimental study, HN-5 head and neck carcinoma cell line (NCBI. C196) was obtained from the Pasteur Institute of Iran (Iran, Tehran). The cells were cultured in the Dulbecco’s modified Eagle’s medium along with 10% fetal bovine serum and incubated at 37°C with 5% CO2 and 1-2% humidity for 24 hours.[
Diode laser (Klas DX-61, Konftec, Taiwan) with 660 nm wavelength, 150 mW power and 45 J/cm2 energy density was used in this study.[
In order to assess apoptosis using flow cytometry, 1 mL of the single cell suspension of each group (containing 1×106 cells) was prepared as described. 1 mL of cell suspension was collected and washed with cold PBS once and suspended in 100 ml of binding buffer. Afterwards, 10 ml of Annexin V-FITC was added, and the mixture was placed on ice for 15 min in the dark. Next, 380 ml of 1X binding buffer and 10 ml of PI were added, incubated on ice for 15 min in the dark, washed with cold PBS once, and suspended with 1 mL of PBS. The apoptosis of the cells was measured using flow cytometry (Beckman Coulter, Inc.). The EXPO32 ADC software (Beckman Coulter, Inc.) was used to analyse the immunofluorescence data and evaluate the apoptosis rate.
For RNA extraction, after reaching 90% cell confluence in a plate, the overlaying medium was removed and the cells were rinsed with PBS. Then, they were detached from the bottom of the plate using trypsin. After neutralizing the enzyme with a medium containing 10% fetal bovine serum, all contents of the plate were transferred into a microtube and centrifuged at 12000 rpm for 2-5 minutes. Next, the supernatant was discarded and 1 mL of ice cold RNX-Plus (Sinaclone, Iran) was added to the tube containing 2 mL of homogenized sample and centrifuged for 5 to 10 seconds. It was then incubated at room temperature for 5 minutes. 200 µL of chloroform (per 1000 mL of RNX-Plus) was added to the contents of the microtube and manually mixed for 15 seconds. It was then placed on ice for 5 minutes and then the microtube was centrifuged at 12000 rpm at 4°C for 15 minutes.
A colourless layer formed on the top while an off-white layer formed at the bottom of the microtube. The interface of these two layers contained DNA and protein and appeared white. The supernatant (aqueous phase) was carefully transferred to a 1.5 mL RNase-free microtube and the same volume of isopropanol was also added to it. The mixture was gently mixed and incubated on ice for 15 minutes. The microtube was then centrifuged at 12000 rpm at 4°C for 15 minutes. The supernatant was discarded and 1 mL of 75% ethanol was added to it and shortly mixed. Next, it was centrifuged at 7500 rpm at 4°C for 8 minutes. The supernatant was discarded. The microtube was placed at room temperature to cool down. After drying, the pellet was dissolved in 50 µL of diethylprocarbonated (DEPC)-treated water. For better dissolution, the microtube was incubated at 55°-60°C for 10 minutes.
Complementary DNA (cDNA) was synthesized using a cDNA synthesis kit (PeqLab Biotechnologie GmbH, Switzerland) according to the manufacturer’s instructions. The final volume of cDNA synthesis reaction was 20 µL. For 20 µL of cDNA, 1 µg of the total RNA was used. For this purpose, 1 µL of random hexamer (Sinaclone, Iran) and 1 µL of oligo (dT) primer (Sinaclone, Iran) were used. For reverse transcription reaction, a mixture of both primers along with 8 µL of DEPC-treated H2O + RNA (1 µg) was used. The thermal protocol for cDNA synthesis reaction included incubation at 65°C for 5 minutes. After complete fixing of primer on RNA at 65°C, Enzyme Mix was added to initiate the enzymatic reaction. The Enzyme Mix included 1 µL of dNTP mix (Sinaclone, Iran), 2 µL of 10X cDNA synthesis MMLUV buffer (Sinaclone, Iran) and 0.5 µL of MMLUV enzyme (Sinaclone, Iran). Around 10 µL of this enzyme was well mixed with the initial primer/RNA and incubated at 42ºC for 1 hour. The obtained cDNA was stored at −20ºC. The concentration of extracted RNA and cDNA was measured by NanoDrop spectrophotometer (NanoDrop 2000™; Thermo Fisher Scientific, Waltham, MA, USA). The optical density of RNA and cDNA at 260 and 280 nm wavelengths was measured and the first value was divided by the second value. Regarding RNA, this value had to be between 1.8 and 2 in order to be acceptable. For cDNA, this value had to be between 1.6 to 1.8 in order to be acceptable and ensure optimal purity of the sample. To observe the quality of extracted RNA and cDNA, RNA and cDNA were run on agarose gel. For this purpose, 1.5% agarose gel was used. It was mixed with 10X TBE buffer. Agarose gel was added to the electrophoresis tank. The voltage of the device was adjusted at 150 V. The gel was evaluated under UV light. Good-quality RNA had two distinct bands on agarose gel; one for 28SrRNA, which is longer and is located on the top and the other one is 18SrRNA, which is shorter and forms at the bottom of the gel.
For designing specific primer, primer-free software was used and for this purpose the number of respective genes was extracted from the NCBI website. By entering the number of each gene in the site, its general characteristics including name and respective sequence were automatically extracted from the database of website. Data were then transferred to primer-free software and the primer was designed taking into account the physical and chemical parameters such as primer length, PCR product, and melting temperature. After obtaining the primer in the form of lyophilized powder from the manufacturer, the primer solution was prepared in 100 pmol/µL concentration by adding sterile distilled water to the powder. This solution was kept at −20°C until use. For final use, the primer was diluted and entered into the final reaction in 10 pmol/µL concentration. The primer sequences for BAX and BCL2 are shown in Table
Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed using Corbett Rotor-GeneTM 3000 (Corbett, Australia) and the QuantiFastTM SYBR® Green RT-qPCR Kit (Qiagen, Germany). The synthesized cDNA served as the template for this reaction; 30 µL of the total RNA was obtained. Considering the capacity of reverse transcription kit and concentration of NanoDrop RNA samples, in each vial, 1 µg of the total RNA of each sample was converted to cDNA. The real time PCR reaction components were 100 ng template, 12.5 µL MasterMix (Applied Biosystems, Foster City, CA, USA), 10 pmol forward and reverse primers, and deionized water to increase the final reaction volume to 25 µL. The temperatures and timings were adjusted according to the instructions provided in the kit (Table
After completion of each cycle, the results were interpreted using amplification and melting peak curves. For this purpose, after each cycle, the melting peak was recorded and if it matched the range of the Corbett’s melting temperature of the gene, it was considered positive. Since the melting temperature is affected by the ionic concentration of the environment as well, values of 1°C higher and lower are also considered acceptable. A negative control was also considered to assess possible contamination. For this purpose, qRT-PCR with the same concentrations, temperatures, and timings was performed without a template (no template sample). Negative result of the reaction ensured no contamination. On the other hand, in order to ensure the quality and quantity of the samples, positive controls were considered in two steps. First, the optical density of the template was measured by NanoDrop and next, the expression of the reference gene was evaluated. Template dilution was also performed for quality control of qRT-PCR. Next, the CT values of BAX and BCL2 genes as well as the positive reference housekeeping gene were recorded. To assess the difference in relative expression of genes in the study groups, the ∆∆CT method was applied. First, the CT values of BAX and BCL2 genes as well as the reference housekeeping gene were extracted for each sample and the two values were subtracted from each other to determine the ∆CT. The mean of ∆CT values was calculated for each group. The two values were subtracted to determine ∆∆CT. 2 squared by -∆∆CT was calculated to assess the difference in gene expression according to the melting peak curve. The normally distributed data were analysed and compared using ANOVA.
ANOVA was applied to compare the 2-∆∆CT value for the BCL2 gene expression among the groups. BCL2 showed significant down-regulation in PDT group (p<0.001). The difference in the 2-∆∆CT value for the BCL2 gene in PDT and control groups was 0.0692, which indicated significant down-regulation of BCL2 in the PDT group (p=0.01). The mean 2-∆∆CT value for BCL2 gene in MB group was 0.322, which indicated down-regulation of this gene after treatment with MB. However, this reduction was not significant (p>0.05). The mean 2-∆∆CT value for BCL2 gene in laser group was 0.358, which indicated a reduction in expression of BCL2 gene in laser group; however, this reduction was not significant either (p>0.05) (Fig.
Using ANOVA for comparing the 2-∆∆CT value of BAX gene among the groups revealed that BAX overexpression in PDT group compared with the control group (p<0.001). The mean 2-∆∆CT value for BAX in PDT group was 49.35, which indicated its significant overexpression in this group (p<0.05). The mean 2-∆∆CT value for BAX in MB group was 42.925, which indicated its overexpression; but it was not statistically significant (p>0.05). The mean 2-∆∆CT value for BAX in laser group was 1.582, which indicated its overexpression after laser treatment; however, it was not significant either (p>0.05).
Based on flow cytometry analysis, cell apoptosis rate of PDT and also MB group was significantly higher than that of control group (p<0.05). The cell apoptosis of group L was higher than that of the control group, but this value wasn’t statistically significant (p>0.05). The flow cytometry results are illustrated in Fig.
| Primer | Sequence |
| GAPDH | F: TCCTGCACCACCTGCTTAG R: TCCACAGTCTTCTGGGTGGCAG |
| BAX | F: GGACGAACTGGACAGTAACATGG R: GCAAAGTAGAAAAGGGCGACAAC |
| BCL2 | F: GCGTCAACAGGGAGATGTCA R: GCATGCTGGGGCCATATAGT |
| Cycle | Cycle point |
| Hold | Hold @ 95°C, 10 min 0 s |
| Cycling (40 repeats) | Step 1: Hold @ 95°C, 20 s |
| Step 2: Hold @ 58°C, 20 s | |
| Step 3: Hold @ 72°C, 20 s, acquiring to Cycling A | |
| Melting | Ramp from 67°C to 95°C |
| Hold for 90 s on the 1st step | |
| Hold for 5 s on next steps, Melt A |
Analysis of relative BAX and BCL2 genes expression revealed the significant difference in BAX and BCL2 between PDT (MB plus L) group in comparison with control group but there are no statistically significant differences between other groups. *** (p<0.001), ** (p = 0.01).
Evidence shows that treatment modalities that can cause down-regulation of BCL2 as an anti-apoptotic protein and upregulation of BAX as a pro-apoptotic protein can be effective against HNSCC. This study assessed the effect of PDT on HNSCC cell apoptosis and the expression of pro-apoptotic BAX and anti-apoptotic BCL2 in HNSCC cell line. The results showed that PDT with diode laser and MB as a photosensitizer caused down-regulation of BCL2 and overexpression of BAX in HNSCC cell line and also cell apoptosis based on flow cytometry. This finding indicated that PDT using MB can be used to induce apoptosis in HNSCC cell line. Reactive oxygen species released in the process of PDT can potentially induce the initiation of apoptosis.[
Kaomongkolgit et al. evaluated the cytotoxic effects of alpha-mangostin on HNSCC cell line for assessment of apoptosis. They assessed the expression of BCL2 and BAX by real time PCR and western blot for evaluation of apoptosis.[
Garg et al. assessed the effect of PDT with erythrosine on malignant and premalignant oral epithelial cells in vitro, aiming to assess the effect of erythrosine as a photosensitizer for PDT on oral malignancies. They evaluated the susceptibility of H357 malignant cells and DOK dysplastic oral mucosal cell line to PDT with erythrosine photosensitizer.[
Induction of apoptosis (but not necrosis) in SCC cell line is among the most efficient, targeted, controlled treatment strategies for SCC with minimal side effects. Cell death should be shifted towards apoptosis instead of necrosis in cancer in order to minimize side effects. By doing so, we can prevent the unwanted death of highly proliferative normal cells such as the oral mucosal cells. Our results indicated that PDT can help us achieve this goal. Thus, it can be recommended as an adjunct to surgery especially in case of presence of residual tumoural involvement at the surgical margins or when the involved margins cannot be completely resected by surgery. Future animal studies followed by clinical trials are required to assess the efficacy of PDT for management of SCC in the clinical setting.
Considering the down-regulation of BCL2 and overexpression of BAX after PDT with a 660-nm diode laser and MB with 3.2 µg/mL concentration, this modality can be effectively used for induction of apoptosis in HNSCC cell line.