Original Article |
|
Corresponding author: Deyana Vankova ( deyana.vankova@mu-varna.bg ) © 2022 Deyana Vankova, Yoana Kiselova-Kaneva, Diana Ivanova.
This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Citation:
Vankova D, Kiselova-Kaneva Y, Ivanova D (2022) Uric acid effects on glutathione metabolism estimated by induction of glutamate-cysteine ligase, glutathione reductase and glutathione synthetase in mouse J744A.1 macrophage cell line. Folia Medica 64(5): 762-769. https://doi.org/10.3897/folmed.64.e65507
|
Introduction: Elevated plasma levels of uric acid (UA) are considered an independent risk factor for hypertension, diabetes, cardiovascular disease, endothelial and vascular damage, obesity, and metabolic syndrome. Even physiological concentrations of soluble UA have been proved to induce gene expression of macrophage-secreted inflammatory cytokines and stimulate production of reactive oxygen species in mature adipocytes. UA is also described as a powerful endogenous plasma antioxidant, which reveals a paradox of duality for this parameter.
Aim: The aim of this study was to investigate the effect of UA on expression of antioxidant defense related enzymes in cultured J744A.1 macrophage cell line.
Materials and methods: Mouse macrophage J744A.1 cells were treated with uric acid at increasing concentrations of 200 to 800 μM. Changes in expression levels of genes related to the metabolism of glutathione – glutamate-cysteine ligase, catalytic subunit (GCLc), glutathione peroxidase 1 (GPx1), glutathione reductase (GR) and glutathione synthetase (GS) were analyzed. Gene expression levels were calculated using the 2-ΔΔCt method.
Results: When UA is applied in concentrations of 200 µM and 400 µM, cell viability did not change significantly. Higher, pathophysiological concentrations of 600 μM, 800 μM UA, and 1000 μM of UA caused significant decrease in cell viability to 95.81% (p<0.01), 76.22% (p<0.001), and 18.01% (p<0.001), respectively. UA treatment in concentrations of 200 μM, 400 μM, 500 μM, and 800 μM induced significant transcription levels of glutathione reductase – 8.14 (p<0.05), 7.15 (p<0.01), 22.07 (p<0.001), and 27.77 (p<0.01), respectively, and of glutathione synthetase – 13.71 (p<0.01), 13.05 (p<0.05), 18 (p<0.01), and 48.60 (p<0.01) folds, respectively. GCLc and GPx1 genes were transcriptionally activated by higher (500 μM and 800 μM) concentrations of UA. For these UA concentrations the measured levels of mRNA were 7.51 (p<0.05) and 12 fold (p<0.05) higher than the non-treated control for GCLc and 1.90 (p<0.05) and 1.93 (p<0.01) for GPx1. Significant difference in the GCLc expression was found between the 200 μM and 500 μM (p<0.05) and 800 μM (p<0.01) treated cells. mRNA levels were significantly different between 400 μM and 800 μM (p<0.05) for both GCLc and GR genes. Very strong correlation was found between GCLc and GR (0.974, p=0.005) and GS (0.935, p=0.020) expression and between GS and GR (0.886, p=0.045) expression levels.
Conclusions: It appears that 500 μM and pathophysiological concentrations (800 μM) of UA induce antioxidant cell response in J744A.1 macrophages proved by the indicative elevation GCL, GPx1, GR, and GS transcription. GR and GS can be stimulated even by lower concentrations (200 μM and 400 μM) indicating that glutathione metabolism in macrophages is tightly regulated in order to keep adequate GSH levels.
glutamate-cysteine ligase, glutathione peroxidase, glutathione reductase, glutathione synthetase, uric acid
Uric acid (UA) is a small, organic, heterocyclic compound which is the final catabolite of purines derived from RNA and DNA.[
Recent studies have indicated that UA acts as an endogenous danger signal and at the same time triggers NOD-like receptor protein 3-dependent inflammation. These effects have been found to have important implications for systemic inflammatory responses.[
On the other hand, UA is described as a powerful endogenous plasma antioxidant which reveals a paradox of duality for this parameter. Uric acid cannot neutralize free radicals such as hydrogen peroxide, hydroxyl radicals, O2-, and peroxynitrite and exhibits fewer antioxidant properties against radicals such as CH3 (methyl radical) and tert-butyl hydroxyperoxide.[
There is still a controversy whether high UA is a compensatory mechanism to overcome increased oxidative stress, which is an independent cause of cardiovascular disease[
Glutathione (GSH) is highly abundant in all cell compartments and is the major soluble antioxidant. Glutamate cysteine ligase (GCL) is the first and rate-limiting enzyme in glutathione biosynthesis and its activity is of high importance for maintaining glutathione levels in the cells.[
Our aim was to investigate the effect of UA on the metabolism of endogenous antioxidant glutathione by estimating UA induced changes in the expression of glutamate-cysteine ligase, glutathione peroxidase, glutathione reductase, and glutathione synthetase in J744A.1 mouse macrophage cell line.
J744A.1 mouse macrophage cells were obtained from the American Type Culture Collection (ATCC). Cells were grown in 75 cm2 flasks at 37°C in a humidified chamber with 5% CO2 atmosphere. The complete nutrient medium was comprised of phenol red-containing Dulbecco’s Modified Eagle’s medium (DMEM, Lonza) with 4.5 g/L glucose, L-glutamine and supplemented with fetal bovine serum (FBS, Sigma-Aldrich) to a 10% final concentration and penicillin/streptomycin mixture to final concentrations of 100 U/mL for each of them.
J744A.1 mouse macrophage cells were collected and seeded in six well flasks at the density of 2.5×105 cells/well. The treatment solutions were prepared using phenol red free DMEM medium containing 4.5 g/L glucose without any supplementations. The uric acid was dissolved in the cell-growing medium without any supplements to reach the following concentrations: 200 μM, 400 μM, 500 μM, 800 μM, and 1000 μM. All concentrations were applied in triplicate.
The viability of the treated cells was estimated using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (commonly abbreviated as MTT assay).[
Total RNA isolation was performed with TRI reagent (Ambion) following the manufacturer’s protocol. RNA (200 ng) was reversely transcribed with First Strand cDNA Synthesis Kit (Thermo Scientific) containing oligo (dT)18 primer and reverse transcriptase. cDNA synthesis was performed on Gene Amp PCR thermal cycler. Reaction conditions were done in final volumes of 10 μL according to the manufacturer’s guidelines. cDNA was dissolved after synthesis by adding 30 μL of nuclease-free distilled water to each sample. Primers for the examined GCL, GPx, GR, GS genes for the quantitative real-time PCR (Table
| Actin beta | F 5’ACG GCC AGG TCA TCA CTA TTG 3’ |
| R 5’CAA GAA GGA AGG CTG GAA AAG 3’ | |
| GCLc | F 5’AATGGAGGCGATGTT 3’ |
| R 5’ CAGAGGGTCGGATGG 3’ | |
| GPx1 | F 5’ CCCCACTGCGCTCATGA 3’ |
| R 5’ GGCACACCGGAGACCAAA 3’ | |
| GR | F 5’CACGGCTATGCAACATTCGC 3’ |
| R 5’TGTGTGGAGCGGTAAACTTTT 3’ | |
| GS | F 5’CCCAAGTGGTCCAGTCTATC 3’ |
| R 5’TCACCAGTGTTGTTCCCTG 3’ |
Two-step real-time PCR analysis was performed to estimate gene expression levels using KAPA Sybr Fast qPCR Kit. The reaction parameters were the following: enzyme activation and denaturation at 95°C/3 min, amplification at 95°C/03 sec, annealing at 60°C/1 min, 45 cycles.
Gene expression levels were calculated using the 2-ΔΔCt method[
Changes in gene expression levels of glutamate-cysteine ligase (GCL), glutathione peroxidase (GPx1), glutathione reductase (GR) and glutathione synthetase (GS) genes were analyzed by real-time qPCR on ABI PRISM 7500 (Applied Biosystems).
Differences among all UA treated groups were analyzed with one-way ANOVA, Tukey’s multiple comparisons test on GraphPad Prism 6 software. Pearson correlation analysis using GraphPad Prism 6 software was applied to evaluate the causal links between the tested parameters. P values less than 0.05 were considered significant.
Results obtained from measuring cell viability are summarized in Fig.
Cell viability of J744A.1 mouse macrophages treated with increasing concentrations of uric acid in culture medium. Cell viability is presented as [%] of viability of non-treated cells, which is considered to be equal to 100%. ** p<0.01 – p value vs. control, ***p<0.001 – p value vs. control. Results are presented as mean±SD.
Uric acid affected differently the expression of enzymes involved in the metabolism of glutathione (Fig.
Relative mRNA units of studied genes. Gene expression is calculated with the delta-delta Ct method (2-∆∆Ct) where the value of mRNA in the control, non-treated group is considered to be equal to 1. * p<0.05 – p value vs. control; ** p<0.01 – p value vs. control, ***p<0.001 – p value vs. control; a – p<0.05– p value vs. 200 μM; aa – p<0.01 – p value vs. 200 μM; # -p<0.05 – p value vs. 400 μM. Results are presented as mean±SEM.
Glutathione reductase expression levels were increased 8.14 (p<0.05) and 7.15 (p<0.01) folds in 200 μM and 400 μM groups. Treatment with UA in 500 μM and in pathophysiological concentration of 800 μM triggered 22.07 (p<0.001) and 27.77 (p<0.01) fold change in the gene expression, respectively.
There was a significant difference between the samples treated with 400 μM and 800 μM of UA (p<0.05).
Application of 200 μM and 400 μM of UA increased significantly the expression levels of GS 13.71 (p<0.01) and 13.05 (p<0.05) folds, respectively. Treatment with the higher concentrations of 500 μM and 800 μM resulted in 18 fold (p<0.01) and 48.60 (p<0.01) elevation of GS mRNA levels. No significant difference between the effects of the applied concentrations was established.
Very strong correlation was established between GCLc and GR (0.974, p=0.005) and GS (0.935, p=0.020) expression and between GS and GR (0.886, p=0.045) expression levels (Table
Cell cultures are a useful model for establishing molecular mechanisms underlying the cellular effects of biologically active compounds, such as metabolites, signaling molecules, drugs etc. In our study, a J744.A1 mouse macrophage cell line was used to illuminate some mechanisms of interrelationship between hyperuricemia and its possible effect on the expression of oxidative stress-related genes.
J744A.1 is a differentiated mouse macrophage cell line and cultured cells secrete inflammatory cytokines in the nutrition medium.[
Up-regulated GCL expression to ensure GSH elevation under conditions of inflammatory and oxidative stimulation seems reasonable, as GCL activity is considered especially important for maintaining GSH levels to provide relevant antioxidant defense. In our study, application of 500 μM and 800 μM of UA elevated significantly the GCL expression levels, thus providing a possible mechanism to ensure glutathione synthesis under conditions of oxidative stimulation by UA. GPx1 catalyzes the neutralization of hydrogen peroxide and organic peroxides and thus protects cells from oxidative stress. Established increase in GPx1 mRNA levels in our study is in accordance with the position of the enzyme on the first-line defense against oxidative stress. Its up-regulation is a part of adaptive mechanisms of the cells.
All the applied UA concentrations (200 μM to 800 μM), both normal and pathological, triggered significant increase in the GR and GS mRNA levels. This stimulation in the respective genes expression is possibly a part of the same mechanism to provide appropriate antioxidant defense by ensuring relevant GSH levels under conditions of oxidative stimulation by UA. Thus, we may assume that increased levels of all studied genes could be a result of the glutathione depletion triggered by UA application.
All of the studied enzymes work in an integrated way, which allows the cell to adapt to stressful conditions associated with impaired redox balance. The link between the up-regulation of glutathione-related genes and UA treatment may be redox and stress-sensitive transcription factors. For example, UA-induced cytokine expression is NF-κB-mediated.[
In our study, we established a very strong positive correlation between mRNA levels of GCLc, GS, and GR on the one hand, and between GR and GS on the other. A possible reason could be that these three enzymes are related to maintenance of adequate reduced glutathione levels, whereas GPx1 is involved in its direct consumption. Maintenance of high GSH levels seems to be of high priority to the antioxidant defense system under UA treatment.
Treatment of J744A.1 macrophage cell line with 500 μM and pathophysiological concentrations (800 μM) of UA induces antioxidant cell response proved by the indicative elevation of GCL, GPx1, GR, and GS transcription. GR and GS can be stimulated even by lower concentrations (200 μM and 400 μM) indicating that glutathione metabolism in macrophages is tightly regulated in order to keep adequate GSH levels.
This study was supported by the national program “Young and Postdoctoral Scientists” provided by Bulgarian Ministry of Science and Education.
The authors have declared that no competing interests exist.
This study shows results from a cell culture experiment. Hyperuricemia is a condition characteristic for a multicellular organism and so the results may not obligatory be related to real pathophysiological conditions. However, we still believe that this study reveals possible molecular mechanisms underlying UA mediated processes in macrophages that can be related to macrophage infiltration in adipose tissue in obesity. One of the limitations of our study is that we measured expression levels on transcriptional level only and the activity and quantity of the studied enzymes was not evaluated.