Tissue samples were collected during colonoscopy analysis as part of routine investigation for colorectal cancer at St Marina University Hospital, Varna, Bulgaria. Samples were immersed in 10% buffered neutral formalin solution for 24 hours before embedding them in paraffin according to a standard university hospital protocol (St Marina University Hospital, Varna, Bulgaria) and were stored at room temperature (RT).

The experimental design is presented in Fig. 1. From a single FFPE tissue block, 3 sections of 5 μm each were cut using a microtome (LEICA RM2235, Germany) and placed in a microcentrifuge tube. The procedure was repeated until nine identical tissue samples were prepared from the same block. Three RNA extraction methods were tested (method A, B, and C) and each method was performed in triplicate.

Figure 1.

Experimental design and workflow, including number of samples for each step followed in the present study.

Deparaffinisation of samples was performed using the following procedure: incubation of each sample with 1 mL xylene, followed by brief vortex and centrifugation at 14 000 rpm/2 min at RT. The procedure was repeated and after xylene removal the sample was washed with 1 mL absolute ethanol. Samples were centrifuged at 14 000 rpm/2 min at RT and ethanol was removed. The procedure was repeated. After ethanol removal, samples were left to air-dry. At this stage, samples were divided in three groups for methods A, B, and C, respectively, each group containing three samples.

Tissue samples were initially treated with 100 μL of Quickextract FFPE RNA extraction Lysis buffer (Epicentre, Illumina, USA). Samples were incubated at 56℃ for 30 min and further heated at 80℃ for 10 min. Then purification was performed using the RNA Clean and Concentrator 5 spin columns (Zymo Research, USA) according to the manufacturer’s protocol. Elution of RNA was performed with 15 μL of DNAse/RNAse free water and stored at −70℃.

Samples were treated with lysis buffer as described in method A. Immediately after the final incubation period (80℃ for 10 min), standard phenol based extraction was performed using Accuzol (Bioneer, USA) and isolated samples were transferred to Clean and Concentrator 5 (Zymo Research, USA) silica spin columns for purification and concentration. Phenol based extraction and column purification steps were performed according to the respective manufacturer’s protocols. RNA was further eluted, as described in method A.

Accuzol (Bioneer, USA) 1 mL was added directly to the deparaffinised tissue samples. The steps followed further were as described in method B.

The concentration and purity of isolated RNA was estimated spectrophotometrically (Synergy 2, Biotek).

For the removal of contaminating gDNA, a DNase reaction was performed adding 2 μL of DNase buffer and 2 μL of DNase I (1 U/μL) (Epicentre, Illumina, USA) to each sample following the manufacturer’s protocol.

For the synthesis of cDNA, 500 ng total RNA template was used. For all of the three replicates from methods A and B, three types of reverse transcription reactions were performed: 1) with oligo dT primer; 2) with oligo dT and random hexamer primer; 3) with gene specific reverse primer (RPL37A: Forward 5’ ATTGAAATCAGCCAGCACGC 3’ and Reverse 5’ AGGAACCACAGTGCCAGATCC 3’). Samples were transcribed using RevertAid cDNA synthesis kit (Thermo Scientific, USA) according to the manufacturer’s protocol.

Preamplification was performed in 50 μL volume PCR reaction for each sample containing: 5 μL template cDNA; 5 μL of Taq DNA polymerase (2U) (New England Biolabs, USA) buffer containing MgCl₂; 2 μL dNTPs (2.5 mM); forward and reverse gene specific primers (RPL37A, see cDNA synthesis) (Sigma-Aldrich, Germany) to a final concentration of 50 nM each; and PCR grade water (Sigma-Aldrich, Germany) up to 50 μL. Samples were amplified in a thermal cycler GeneAmp PCR System 9700 (Applied Biosystems, USA). Initial denaturation was performed at 95℃ for 5 min, followed by 95℃ for 15 s and 60℃ for 4 min for 5 cycles. Samples were finally cooled down to 4℃ and stored at −20℃. The samples were placed on ice during all preparations. Each DNA-se treated sample provided a single preampified sample.

Results were validated by qPCR using standard SYBR Green qPCR Master Mix (Thermo Scientific, USA). Reactions in total volume of 10 μL were performed for each sample (preamplified and non-preamplified) as follows: 5 μL Master Mix with ROX dye; gene specific primers (RPL37A, see cDNA synthesis) (Sigma-Aldrich, Germany) to a final concentration of 0.25 μM each and 4 μL 10× diluted preamplified or non-preamplified cDNA. Reaction conditions were as follows: initial denaturation at 95℃ for 10 min, followed by 95℃ for 15 s and 63℃ for 1 min for 40 cycles. Melting curve was added at the end of each qPCR analysis. Reactions were performed in triplicate.

Absolute quantification method was performed and standard curve was created to assess preamplification efficacy of gene specific primed cDNA strategy for RNA isolation methods A and B. A serial decimal dilutions of the non-preamplified cDNA (25 ng/μL, 2.5 ng/μL, 0.25 ng/μL, 0.025 ng/μL, 0.0025 ng/μL) were used as standard. The change in Ct value resulting from preamplification was analysed by calculating the initial concentration of the template before preamplification (C=2.5 ng/μL) and running qPCR with the same template volume of preamplified product, using SYBR Green qPCR Master Mix (Thermo Scientific, USA) according manufacturer’s protocol. RPL37A gene primer set (see cDNA synthesis) was used in performing of qPCR.

Data were analysed using GraphPad Prism V6 software. For the estimation of statistical significance, single-way and two-way ANOVA statistical analyses were performed. P values <0.05 were considered as statistically significant.

Analysis of concentration of RNAs obtained by the three different methods showed that combination of lysis buffer extraction with phenol-chloroform extraction (method B) outperformed the other methods (A and C) (Table 1).

Average Ct values of qPCR reactions of preamplified and non-preamplified samples, obtained after RNA extraction with methods A and B are presented in Table 2.

Gene specific primed cDNA synthesis gave significantly lower Ct values (p<0.001) for both RNA extraction methods (A and B) compared to oligo dT and to combination of oligo dT and random hexamer primers, for both non-preamplified and preamplified cDNA samples (Table 2). For non-preamplified cDNA samples of both RNA extraction methods, application of gene specific priming strategy resulted in significantly lower Ct (p<0.001) also compared to combined oligo dT and random hexamer priming strategy. Melting curve analysis resulted in clear peaks for all repetitions for both methods A and B for the case of gene specific primer strategy.

Application of oligo dT priming strategy resulted in a statistically significant lower Ct value in RNA extraction method A than in method B, on non-preamplified (p<0.01) and on preamplified cDNA templates (p<0.01). This could be attributed to the ability of lysis buffer extraction, solely, to result in higher ratio of intact to fragmented, short RNAs, compared to concomitant phenol-based extraction.‌^[9]

Comparing Ct values between non-preamplified and preamplified cDNA templates for all three priming strategies to assess the efficacy of preamplification, we noticed statistically significant improvement for both RNA extraction methods A (p<0.01) and B (p<0.001) (Fig. 2). The Ct values of method A for oligo dT, combined oligo dT and random hexamer and gene specific priming strategies were lowered respectively by 1.78 (p<0.05), 7.52 (p<0.01), 3.03 (p<0.01) when cDNA preamplification was applied. According to method B, the preamplification lowered Ct values by 2.96 (p<0.01) for oligo dT, by 7.97 (p<0.001) for combined oligo dT and random hexamer, and by 3.90 (p<0.001) for gene specific priming strategies. The average of methods A and B decrease of Ct values for oligo dT and for gene specific primed cDNA were 2.37±0.82 and 3.46±0.61, respectively. The oligo dT+random hexamer primed cDNA gave an average decrease of Ct value by 7.74±0.32, which corresponded to a higher efficiency than expected, thus indicating the need of additional validation of the analysis by performing absolute quantification to assess the preamplification efficiency.

Figure 2.

Comparison of Ct values obtained through two-step qPCR of non-preamplified and preamplified cDNA samples. Data are presented as mean ±SD of FFPE tissue samples for both RNA extraction methods utilizing three different reverse transcription priming strategies (oligo dT; oligo dT+random hexamer; gene specific reverse primer). **p<0.01 vs. RNA extraction method A; ^#p<0.05, ^##p<0.01, ^###p<0.001 vs. respective priming strategy and RNA extraction method w/o preamplification. A. Lysis buffer RNA extraction (grey); B. lysis buffer and phenol-based RNA extraction (dark grey).

By performing an absolute quantification, to assess preamplification efficacy of gene specific primed cDNA strategy for RNA isolation methods A (Fig. 3A) and B (Fig. 3B), we found that the Ct value for preamplified template was 5.5 cycles lower for method A as well as for B, corresponding to 5.5 Ct of preamplification, although the preamplification run was performed for 5 cycles. Evaluation of quantification efficiency was confirmed by high r² score for RNA isolation methods A and B where r²=0.9915 and r²=0.9653, respectively.

Figure 3.

Relative quantification for construction of standard curve of gene specific primed cDNA for calculation of the preamplification efficiency, by taking r² (R square) value. Used standard dilutions of non-preamplified cDNA were 25 ng/μL, 2.5 ng/μL, 0.25 ng/μL, 0.025 ng/μL, 0.0025 ng/μL. Preamplified unknown cDNA sample volume was corresponding to the volume of 2.5 ng/μL standard dilution. A) RNA extraction method A; B) RNA extraction method B. Legend: standard dilutions (●); unknown sample (♦).